View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_low_46 (Length: 287)
Name: NF15299_low_46
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 280
Target Start/End: Original strand, 46892170 - 46892431
Alignment:
| Q |
19 |
tcattatggctattggcacctccctcaccatcctaacccacacccccaacctccgctccaccaccatctgtttccctcctcatacccctccaaatggtcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46892170 |
tcattatggctattggcacctccctcaccatcctaactcacacccccaacctccgctccaccaccatatgtttccctcctcatacccctccaaatggtcc |
46892269 |
T |
 |
| Q |
119 |
cctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctcttcataatcctatcaagatccatcaaacgcctctcattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46892270 |
cctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctcttcatcatcctatcaagatccatcaaacgcctctcattc |
46892369 |
T |
 |
| Q |
219 |
ctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctca |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892370 |
ctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctca |
46892431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University