View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15299_low_59 (Length: 238)

Name: NF15299_low_59
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15299_low_59
NF15299_low_59
[»] chr5 (1 HSPs)
chr5 (41-225)||(23923743-23923928)


Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 23923743 - 23923928
Alignment:
41 aatgtatcaaatgtatttatctacttgtatttctaggataaaatttcttcaatgaacacaattaatgatagccaccgctactnnnnnnn-tcagaatggt 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||    
23923743 aatgtatcaaatgtatttatctacttgtatttctaggataaaatttcttcaatgaacacaattaatgatagccaccgctactaaaaaaaatcagaatggt 23923842  T
140 atggtccaagaaatagaaaagaaagaaacaagtgtgagtcacgaggatcgaaattggaaaggcccactgtacatgaaaaattgtct 225  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23923843 atggtccaagaaatagaaaagaaagaaacaaatgtgagtcacgaggatcgaaattggaaaggcccactgtacatgaaaaattgtct 23923928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University