View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_low_69 (Length: 222)
Name: NF15299_low_69
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_low_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 3641708 - 3641902
Alignment:
| Q |
21 |
agggcagttgctgaattcagcagactctgaatgaattttaagagactaaccatatagtgtttacagagagaaaggatcgta---------tcaaaagtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
3641708 |
agggcagttgctgaattcagcagactctgaatgaattttaagagactaaccatataatgtttacagagagaaaggatcgtatcaaaaggttcaaaagtta |
3641807 |
T |
 |
| Q |
112 |
taaatgaagtcaaaatttggccaacgtgttgttgcaagaatcaaattcacgatgtcaccggatcaaact---tcatatattttcactgatgttac |
203 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3641808 |
taaatgaagtcaaaatttggccaacatgttgttacaagaatcaaattcacgatgtcaccggatcaaacttcatcatatattttcactgatgttac |
3641902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University