View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15299_low_71 (Length: 220)
Name: NF15299_low_71
Description: NF15299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15299_low_71 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 28081337 - 28081131
Alignment:
| Q |
1 |
agttctaattccttctttgttgcacctaattgtatctccaattcgcctttcgacgattccagcccttgtagcttcgatttcaattcatttatataagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
28081337 |
agttctaattccttctttgttgcacctaattgtttctccaattcaccttttgacgattccagcccttgtagcttcgatttcaattcgtttatataagata |
28081238 |
T |
|
| Q |
101 |
tagcatcgcctaggagcgatgctttgtccattttagaaacatttggaaccacagcacgtagagcatagaatttctggttaagcttttctcttctttgtct |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28081237 |
tagcatcgcctagcagcgatgctttgtccatcttagaaacatttggaaccacagcacgtagagcatagaatttttggttaagcttttctcttctttgtct |
28081138 |
T |
|
| Q |
201 |
ctctgct |
207 |
Q |
| |
|
||||||| |
|
|
| T |
28081137 |
ctctgct |
28081131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 207
Target Start/End: Complemental strand, 9194878 - 9194792
Alignment:
| Q |
121 |
gctttgtccattttagaaacatttggaaccacagcacgtagagcatagaatttctggttaagcttttctcttctttgtctctctgct |
207 |
Q |
| |
|
||||| ||||| || ||||| ||||||||||||| | || |||||||||| | ||||| || || ||||| ||||||||||||||| |
|
|
| T |
9194878 |
gctttatccatctttgaaacgtttggaaccacagatcttaaagcatagaatctatggtttagtttctctctcctttgtctctctgct |
9194792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 203
Target Start/End: Complemental strand, 12886003 - 12885921
Alignment:
| Q |
121 |
gctttgtccattttagaaacatttggaaccacagcacgtagagcatagaatttctggttaagcttttctcttctttgtctctc |
203 |
Q |
| |
|
||||||||||| || |||||||| ||||| || || || || ||||||||| |||| || ||||| ||||||||||| ||||| |
|
|
| T |
12886003 |
gctttgtccatctttgaaacattaggaacaaccgctcgaagtgcatagaatctctgattcagcttctctcttctttgcctctc |
12885921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University