View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_28 (Length: 298)
Name: NF1529_high_28
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 108 - 282
Target Start/End: Complemental strand, 33129129 - 33128956
Alignment:
| Q |
108 |
ccaacaaattaaacatgccatcatataattacacatgaatactgaaacnnnnnnnn-tcctaatctctgtaatgtacaaaccctaacacgcatagaacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
33129129 |
ccaacaaattaaacatgccatcatataattacacatgaataccgaaacaaaaagaaatcc--atctctgtaatgttcaaaccctaaaacgcatagaacca |
33129032 |
T |
 |
| Q |
207 |
tcatacttatgtagtttgaatccaaaagtcattcaaaacaatgacatgttatctaccgaaaacttgctgctctaga |
282 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33129031 |
tcgtacttatgtagtttgaatccaaaagtcattcaaaacaatgacatgttatctaccgaaaacttgctgctctaga |
33128956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University