View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_50 (Length: 235)
Name: NF1529_high_50
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 16758241 - 16758375
Alignment:
| Q |
1 |
ctattgaaggttttattctttatactttgtctcttattaagtttgcaatttacggtgctaaatctgctgtctcacacgtagtcctcagggagtttaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16758241 |
ctattgaaggttttattctttatactttgtctcttattaagtttgcaatttacggtgctaaatctgctgtctcacacgtagtcctcagggagtttaagac |
16758340 |
T |
|
| Q |
101 |
atgcatccttcttctaggaaactattatctctttg |
135 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16758341 |
atgcatccttcatctaggaaactattatctctttg |
16758375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 3 - 135
Target Start/End: Original strand, 16753409 - 16753541
Alignment:
| Q |
3 |
attgaaggttttattctttatactttgtctcttattaagtttgcaatttacggtgctaaatctgctgtctcacacgtagtcctcagggagtttaagacat |
102 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| ||| | ||||||||||| | |||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
16753409 |
attgaacgttttattctttatactctgtctctcattgactttgcaatttagagcgctaaatctgctgtcttgcatgtagtcctcagggagtttaagacat |
16753508 |
T |
|
| Q |
103 |
gcatccttcttctaggaaactattatctctttg |
135 |
Q |
| |
|
|| | || ||| |||||||||||||||||||| |
|
|
| T |
16753509 |
gcgttctgctttgaggaaactattatctctttg |
16753541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 44 - 135
Target Start/End: Original strand, 16745350 - 16745441
Alignment:
| Q |
44 |
tgcaatttacggtgctaaatctgctgtctcacacgtagtcctcagggagtttaagacatgcatccttcttctaggaaactattatctctttg |
135 |
Q |
| |
|
|||||||||| |||||| ||||||||| || ||||| ||||| || ||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
16745350 |
tgcaatttacagtgctacatctgctgtttcgcacgttgtccttgggcagtttaagacatgcatcctgcttctaggaaactattttctctttg |
16745441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 159 - 220
Target Start/End: Complemental strand, 7494833 - 7494772
Alignment:
| Q |
159 |
cattgttgatcaactatacttaccaacattctctcaaatttatctttcattactgtctttcg |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7494833 |
cattgttgatcaactatatttaccaacattctctcaaatttatccttcattactgtctttcg |
7494772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 7873952 - 7874014
Alignment:
| Q |
159 |
cattgttgatcaactatacttacc-aacattctctcaaatttatctttcattactgtctttcg |
220 |
Q |
| |
|
||||||||||||||||| |||| | |||||||| |||||||||||||| | |||||| ||||| |
|
|
| T |
7873952 |
cattgttgatcaactatccttaactaacattctatcaaatttatcttttagtactgtttttcg |
7874014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University