View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_52 (Length: 229)
Name: NF1529_high_52
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_52 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 48765574 - 48765346
Alignment:
| Q |
1 |
acaatgtctccaaatccagcttcgtctcaccgtccaccgttaccaacgtgccttcattcggaagcttcccgttgtccacaacgatacttttaatgtcgcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48765574 |
acaatgtctccaaatccagcttcgtctcaccgtccaccgttaccaacgtgccttcattcggaagcttcccgttgtccacaatgatacttttaatgtcgcg |
48765475 |
T |
|
| Q |
101 |
gtcactctcatccgagcttggatcttctgatatctcgtcttgtttaatcgttaaacaacacggagaacattgaagtagtgaatttgtttgtgttttcaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
48765474 |
ttcactctcatccgagcttggatcttctgatatctcgtcttgtttaatcgttaaacaacacggagaacattgaagtcgtgaatgtgtttgtgttttcaca |
48765375 |
T |
|
| Q |
201 |
tcttcttggtcttgttgcacaacagtttc |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
48765374 |
tcttcttggtcttgttgcacaacactttc |
48765346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University