View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_55 (Length: 222)
Name: NF1529_high_55
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 39031441 - 39031632
Alignment:
| Q |
13 |
gcagagattattataagaaaaaaggaaggctgaggaaggagcagctaaagcaagtcatgagtaaacaatcgaaggagcagctgtaggcgacttagttgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39031441 |
gcagagattattataagaaaaaaggaaggctgaggaaggagcagctaaagcaagtcatgagtaaacaatcgaaggagcagctgtaggcgacttagttgaa |
39031540 |
T |
 |
| Q |
113 |
aattccaatccgtggctgctgattctgatccatccatatctggagtaaacatctacatctgatactgaaaatgacgaaaattctgctcattt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39031541 |
aattccaatccgtggctgctgattctgatccatccatatttggagtaaacatctacatctaatactgaaaatgacgaaaattctgctcattt |
39031632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 39026814 - 39026875
Alignment:
| Q |
100 |
cgacttagttgaaaattcc-aatccgtggctgctgattctgatccatccatatctggagtaa |
160 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
39026814 |
cgacttagttaaaaattcccaatctgtggctgatgatactgatccatctatatctggagtaa |
39026875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 39026732 - 39026768
Alignment:
| Q |
27 |
aagaaaaaaggaaggctgaggaaggagcagctaaagc |
63 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
39026732 |
aagaaaaaaggaaggccgaggaagcagcagctaaagc |
39026768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University