View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_62 (Length: 205)
Name: NF1529_high_62
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 28115838 - 28115641
Alignment:
| Q |
1 |
taaaacactgattttgtacctatgttattgataagtattttttg-gtataattaggaaattaaaatgtaagatcaaaattaacttgattctatttgaagg |
99 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||| |||||| || ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28115838 |
taaaacactgattttgtacccttgttatagataagtattttttttgtataactaagaaattaaaatgtgagatcaaaattaacttgattctatttgaagg |
28115739 |
T |
 |
| Q |
100 |
attgagcatttatagtgaaatagataggggaagacaatgtttgaggttgagcttgctagtattgtcatcttataagagacagcacattggttcatctc |
197 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28115738 |
attgagcatttatattgaaatagataagtgaagacaatgtttgaggttgtgcttgctagtctggtcatcttataagagacagcacattggttcatctc |
28115641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University