View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_high_8 (Length: 424)
Name: NF1529_high_8
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_high_8 |
 | |
|
| [»] scaffold0683 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0683 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0683
Description:
Target: scaffold0683; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 4914 - 4866
Alignment:
| Q |
10 |
catcatcagattttccttaacatggctcttcctcacactatatgtatca |
58 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4914 |
catcataagattttccttgacatggctcttcctcacactatatgtatca |
4866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University