View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_low_28 (Length: 303)
Name: NF1529_low_28
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 27572070 - 27572123
Alignment:
| Q |
98 |
cggctgttatgagatgcaaaatcgtctattaaattatcataataattatttaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27572070 |
cggctgttatgagatgcaaaatcgtctattaaattatcataataattatttaac |
27572123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 230 - 303
Target Start/End: Original strand, 27572202 - 27572275
Alignment:
| Q |
230 |
gaaaaactaagttccatagaagcagcannnnnnnngaagaagctaaatcaagcaccagagataatcgaacctga |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27572202 |
gaaaaactaagttccatagaagcaacattttttttgaagaagctaaatcaagcaccagagaaaatcgaacctga |
27572275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University