View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_low_34 (Length: 280)
Name: NF1529_low_34
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 14138307 - 14138571
Alignment:
| Q |
1 |
gaagaagaagaagcttctggttcaagttctggttctggtggtttggaacaagaacaacgtaaggtttcaagatctagatctgttggatgtggcagcagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14138307 |
gaagaagaagaagcttctggttcaagttccggttctggtggtttggatcaagaacaacgtaaggtttcaagatctagatctgttggatgtggtagcagaa |
14138406 |
T |
 |
| Q |
101 |
gcttctctggtgatttctttgagaaaatctcaactgggtttggagattgtaccttaagaagagtggaatcccaacgtgaaggcaagggtagtaaagtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14138407 |
gcttctctggtgatttctttgagaaaatctcaactgggtttggagattgtaccttaagaagagtggaatctcaacgtgaaggcaagggtagtaaagtaat |
14138506 |
T |
 |
| Q |
201 |
ttcatcttctgctgttgctggaaatggaaatattcaacactgcatgaaggaaagagtgaagtgtg |
265 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14138507 |
ttcatcttctgttgttgctggaaatggaaatattcaacactgcatgaaggaaagagtgaagtgtg |
14138571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 56 - 182
Target Start/End: Complemental strand, 49766361 - 49766235
Alignment:
| Q |
56 |
aacgtaaggtttcaagatctagatctgttggatgtggcagcagaagcttctctggtgatttctttgagaaaatctcaactgggtttggagattgtacctt |
155 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||| | |
|
|
| T |
49766361 |
aacgtaaagtttcaagatctagatctgttggatgtggtagcagaagcttctctggtgatttctttgaaagaatttcaactgggtttggagattgtactct |
49766262 |
T |
 |
| Q |
156 |
aagaagagtggaatcccaacgtgaagg |
182 |
Q |
| |
|
|||||||| ||||| ||||||||||| |
|
|
| T |
49766261 |
cagaagagttgaatctcaacgtgaagg |
49766235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University