View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_low_52 (Length: 238)
Name: NF1529_low_52
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 1035140 - 1034919
Alignment:
| Q |
1 |
gtaaagaccaatgtaatttgatcccttatctggttctcgtataaaagcgcaaaggaactttcaatccaacaatgagttttgcatatagatatccgataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1035140 |
gtaaagaccaatgtaatttgatcccttatctggttctcgtataaaagtgcaaaggaactttcaatccaacaatgagttttgcatatagatatccgataaa |
1035041 |
T |
|
| Q |
101 |
aagttattgaacagtatgacaatatctaagtattacactgatgtaatttgatcctctctacacaca--cacattgaatgtgaagtgaaagagtcataaca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1035040 |
aagttattgaacagtatgacaatatctaagtattacactgatgtaatttgatcctctctacacacacacacattgaatgtgaagtgaaagagtcataaca |
1034941 |
T |
|
| Q |
199 |
gacaagttttgaatgagaaaac |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1034940 |
gacaagttttgaatgagaaaac |
1034919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University