View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1529_low_65 (Length: 206)
Name: NF1529_low_65
Description: NF1529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1529_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 20624932 - 20624857
Alignment:
| Q |
113 |
caaactttatggaatattttagaaattcattgtacaaatatagtaggttgctttgaccttaccttgactgaggttc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20624932 |
caaactttatggaatattttagaaattcattgtacaaatatagtaggttgctttgaccttaccttgactgaggttc |
20624857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 20625047 - 20624991
Alignment:
| Q |
1 |
acctaggcattcaagtaaattgagaaacctatc---ttctcagtttctcatcatgtc |
54 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20625047 |
acctaggcattcaagtaaactgagaaacctatcctgttctcagtttctcatcatgtc |
20624991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University