View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15301_high_2 (Length: 367)
Name: NF15301_high_2
Description: NF15301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15301_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 14177383 - 14177731
Alignment:
| Q |
1 |
atgtctgtggagatgtgttgaagaaaaatattgcttcattgggaccattggttttaccatggagggagcaattcctatatgtcgtttcaattatttatca |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14177383 |
atgtttgtggagatgtgttgaagaaaaatattgcttcattgggaccattggttttaccatggagggagcaattcttatatgtcgtttcaattatttatca |
14177482 |
T |
 |
| Q |
101 |
caaactttggagtagaagaagaagaacaagcatatatactccgaaattcaatagggcttttgagcatttctgcatacattcaggaggaagagctgttata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177483 |
caaactttggagtagaagaagaagaacaagcatatatactccgaaattcaatagggcttttgagcatttctgcatacattcaggaggaagagctgttata |
14177582 |
T |
 |
| Q |
201 |
caagccattgagaaaaatttgaagctaaggagagaggatgttgagccatcaaaaatgactctgtacagatttggaaacacttcatcttcttcaatttggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177583 |
caagccattgagaaaaatttgaagctaaggagagaggatgttgaaccatcaaaaatgactctgtacagatttggaaacacttcatcttcttcaatttggt |
14177682 |
T |
 |
| Q |
301 |
atgagttgtcatatattgaagcaaaagggaggatgaaatgtggagatag |
349 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177683 |
atgagttgtcatacattgaagcaaaagggaggatgaaatgtggagatag |
14177731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University