View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_high_28 (Length: 479)

Name: NF15302_high_28
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_high_28
NF15302_high_28
[»] chr1 (94 HSPs)
chr1 (270-454)||(35417742-35417926)
chr1 (91-264)||(34725098-34725271)
chr1 (91-264)||(38478282-38478455)
chr1 (91-264)||(46247953-46248128)
chr1 (91-264)||(32632557-32632731)
chr1 (91-264)||(19414422-19414595)
chr1 (91-260)||(45812541-45812710)
chr1 (91-252)||(47214494-47214655)
chr1 (91-261)||(46991787-46991959)
chr1 (91-264)||(14617021-14617196)
chr1 (91-264)||(30395726-30395903)
chr1 (122-264)||(35253187-35253329)
chr1 (91-264)||(12126837-12127010)
chr1 (91-264)||(18944626-18944804)
chr1 (91-264)||(20004090-20004267)
chr1 (102-264)||(41319806-41319970)
chr1 (100-259)||(23768325-23768486)
chr1 (91-264)||(10668203-10668385)
chr1 (102-264)||(27474275-27474438)
chr1 (91-261)||(45402078-45402251)
chr1 (96-242)||(18724567-18724714)
chr1 (106-264)||(27201645-27201807)
chr1 (104-260)||(6925096-6925254)
chr1 (91-264)||(8197026-8197201)
chr1 (96-242)||(11596502-11596648)
chr1 (91-264)||(18741957-18742136)
chr1 (96-264)||(6983811-6983978)
chr1 (91-229)||(22930104-22930242)
chr1 (5-92)||(35417923-35418010)
chr1 (96-254)||(2435796-2435956)
chr1 (96-234)||(20036209-20036349)
chr1 (124-264)||(35005139-35005283)
chr1 (149-264)||(31382214-31382330)
chr1 (107-264)||(35117765-35117927)
chr1 (171-265)||(4349703-4349797)
chr1 (108-243)||(25468284-25468421)
chr1 (96-210)||(4430080-4430196)
chr1 (91-264)||(9939443-9939622)
chr1 (96-212)||(33222972-33223090)
chr1 (107-266)||(10378733-10378884)
chr1 (96-234)||(19932783-19932922)
chr1 (107-250)||(17470361-17470505)
chr1 (108-252)||(19701570-19701717)
chr1 (108-255)||(44485119-44485267)
chr1 (96-264)||(50811928-50812098)
chr1 (96-262)||(15511150-15511320)
chr1 (96-209)||(34679274-34679388)
chr1 (96-260)||(22327088-22327250)
chr1 (150-264)||(23796507-23796623)
chr1 (174-242)||(15505632-15505700)
chr1 (91-174)||(25290146-25290231)
chr1 (107-202)||(50760288-50760385)
chr1 (91-160)||(34714606-34714675)
chr1 (108-261)||(39214961-39215117)
chr1 (107-207)||(52910216-52910319)
chr1 (108-255)||(23371124-23371271)
chr1 (171-264)||(42304207-42304302)
chr1 (107-174)||(2435985-2436052)
chr1 (96-260)||(35019219-35019383)
chr1 (201-264)||(50606498-50606561)
chr1 (91-152)||(40424725-40424786)
chr1 (139-242)||(30682845-30682948)
chr1 (149-268)||(20169085-20169206)
chr1 (140-262)||(22324925-22325049)
chr1 (171-264)||(1517311-1517404)
chr1 (118-210)||(31272429-31272522)
chr1 (150-255)||(34148969-34149076)
chr1 (172-264)||(43768205-43768297)
chr1 (124-252)||(45264411-45264542)
chr1 (91-207)||(24564327-24564445)
chr1 (171-257)||(31442396-31442483)
chr1 (197-259)||(4587568-4587630)
chr1 (171-264)||(20999850-20999943)
chr1 (99-172)||(22151495-22151568)
chr1 (91-212)||(18335340-18335463)
chr1 (171-227)||(21910686-21910742)
chr1 (107-219)||(27136696-27136811)
chr1 (91-174)||(10163742-10163825)
chr1 (119-264)||(19974074-19974221)
chr1 (96-171)||(25554817-25554891)
chr1 (102-172)||(21723658-21723727)
chr1 (171-264)||(46859131-46859225)
chr1 (212-264)||(19386576-19386628)
chr1 (148-192)||(44745857-44745901)
chr1 (108-151)||(28894646-28894689)
chr1 (101-192)||(14987991-14988084)
chr1 (118-160)||(43768168-43768210)
chr1 (187-252)||(4249455-4249520)
chr1 (187-252)||(4249779-4249844)
chr1 (187-252)||(4250103-4250168)
chr1 (227-264)||(21773639-21773676)
chr1 (221-262)||(42432226-42432267)
chr1 (152-207)||(21723728-21723784)
chr1 (112-251)||(49722586-49722726)
[»] chr8 (61 HSPs)
chr8 (91-264)||(12670250-12670423)
chr8 (91-264)||(30454097-30454270)
chr8 (96-265)||(17823541-17823712)
chr8 (98-265)||(13160669-13160837)
chr8 (91-264)||(28817626-28817801)
chr8 (91-264)||(36720756-36720931)
chr8 (91-264)||(35261639-35261814)
chr8 (91-264)||(39460994-39461171)
chr8 (90-241)||(20869523-20869672)
chr8 (91-264)||(7136527-7136704)
chr8 (91-264)||(2626479-2626657)
chr8 (91-263)||(45071225-45071398)
chr8 (91-264)||(44530109-44530284)
chr8 (96-264)||(6760787-6760959)
chr8 (91-264)||(29521685-29521860)
chr8 (100-264)||(12625858-12626025)
chr8 (96-260)||(18164764-18164929)
chr8 (91-264)||(25250482-25250659)
chr8 (97-264)||(8897764-8897933)
chr8 (91-258)||(20284075-20284248)
chr8 (91-258)||(21070703-21070877)
chr8 (108-242)||(24365081-24365218)
chr8 (91-264)||(26954092-26954270)
chr8 (96-264)||(28407381-28407538)
chr8 (113-264)||(31457155-31457307)
chr8 (91-234)||(11748259-11748406)
chr8 (152-264)||(19729363-19729475)
chr8 (96-263)||(42083699-42083868)
chr8 (96-251)||(44781517-44781675)
chr8 (132-264)||(5135290-5135423)
chr8 (140-259)||(5689640-5689761)
chr8 (96-255)||(8483947-8484107)
chr8 (149-264)||(20869941-20870060)
chr8 (91-242)||(24245411-24245562)
chr8 (107-252)||(22598133-22598279)
chr8 (149-262)||(29877112-29877227)
chr8 (157-266)||(16225045-16225158)
chr8 (194-264)||(26102582-26102652)
chr8 (107-228)||(11000985-11001109)
chr8 (96-230)||(14018002-14018138)
chr8 (117-221)||(23000262-23000365)
chr8 (110-212)||(35105902-35106007)
chr8 (153-264)||(10857850-10857964)
chr8 (130-254)||(389642-389770)
chr8 (157-265)||(23286336-23286432)
chr8 (96-174)||(30962865-30962942)
chr8 (142-261)||(17250879-17251001)
chr8 (204-263)||(27507985-27508044)
chr8 (107-261)||(44742521-44742678)
chr8 (91-264)||(40604906-40605080)
chr8 (122-160)||(27635020-27635058)
chr8 (139-265)||(33866957-33867088)
chr8 (215-264)||(27468092-27468141)
chr8 (201-264)||(16013528-16013591)
chr8 (201-264)||(35107311-35107374)
chr8 (155-220)||(43942348-43942417)
chr8 (176-257)||(26457776-26457855)
chr8 (91-128)||(23286431-23286468)
chr8 (109-227)||(36918102-36918222)
chr8 (175-250)||(30231344-30231420)
chr8 (100-160)||(40607830-40607890)
[»] chr7 (77 HSPs)
chr7 (91-264)||(21172009-21172182)
chr7 (91-264)||(32758221-32758394)
chr7 (96-265)||(10693072-10693241)
chr7 (91-267)||(48735119-48735296)
chr7 (113-264)||(42391100-42391251)
chr7 (91-265)||(2541018-2541195)
chr7 (96-264)||(19426890-19427059)
chr7 (91-260)||(47077859-47078028)
chr7 (98-263)||(11617589-11617756)
chr7 (91-264)||(42798629-42798804)
chr7 (91-264)||(42805484-42805661)
chr7 (91-263)||(42476833-42477005)
chr7 (96-264)||(27629599-27629769)
chr7 (91-267)||(47716419-47716599)
chr7 (90-262)||(35334818-35334990)
chr7 (94-264)||(19265779-19265948)
chr7 (87-264)||(40463833-40464011)
chr7 (110-263)||(11741774-11741927)
chr7 (91-264)||(43557432-43557610)
chr7 (105-267)||(33871907-33872070)
chr7 (99-264)||(34626208-34626374)
chr7 (128-264)||(31591109-31591245)
chr7 (91-267)||(22698964-22699145)
chr7 (91-234)||(46354154-46354301)
chr7 (91-254)||(2662946-2663106)
chr7 (91-264)||(14732821-14732997)
chr7 (96-265)||(23419673-23419843)
chr7 (96-242)||(13805068-13805214)
chr7 (107-227)||(14099043-14099165)
chr7 (107-227)||(14409060-14409182)
chr7 (114-264)||(32233135-32233286)
chr7 (96-255)||(28362155-28362314)
chr7 (135-264)||(7879642-7879773)
chr7 (117-263)||(18747472-18747621)
chr7 (96-240)||(48123508-48123653)
chr7 (107-263)||(29907393-29907552)
chr7 (91-203)||(5180218-5180332)
chr7 (130-262)||(18512455-18512588)
chr7 (91-183)||(42495917-42496010)
chr7 (107-242)||(19266426-19266563)
chr7 (97-234)||(28078162-28078300)
chr7 (91-183)||(18326994-18327087)
chr7 (122-264)||(38262196-38262340)
chr7 (135-255)||(21566439-21566562)
chr7 (91-220)||(8148989-8149121)
chr7 (97-252)||(39123857-39124018)
chr7 (106-219)||(7644931-7645047)
chr7 (150-256)||(38604546-38604654)
chr7 (91-174)||(1424002-1424085)
chr7 (99-174)||(7794598-7794673)
chr7 (108-209)||(6736867-6736969)
chr7 (91-173)||(7193045-7193127)
chr7 (96-203)||(12473269-12473378)
chr7 (107-263)||(16341254-16341413)
chr7 (156-264)||(35787269-35787378)
chr7 (149-265)||(23231575-23231693)
chr7 (91-264)||(25198682-25198861)
chr7 (185-264)||(27889316-27889395)
chr7 (96-263)||(3469176-3469348)
chr7 (107-174)||(44123713-44123780)
chr7 (143-234)||(1408469-1408562)
chr7 (91-174)||(21447550-21447633)
chr7 (129-242)||(35203437-35203554)
chr7 (186-264)||(23065925-23066003)
chr7 (107-229)||(42101919-42102044)
chr7 (134-237)||(15108424-15108528)
chr7 (106-224)||(22065563-22065682)
chr7 (96-139)||(29140487-29140530)
chr7 (172-239)||(33500556-33500625)
chr7 (172-264)||(39093439-39093532)
chr7 (204-264)||(45018923-45018983)
chr7 (96-174)||(5814436-5814514)
chr7 (185-254)||(36267827-36267897)
chr7 (223-264)||(36602541-36602582)
chr7 (195-251)||(21139761-21139817)
chr7 (152-264)||(23618977-23619088)
chr7 (101-133)||(28685267-28685299)
[»] chr6 (50 HSPs)
chr6 (91-264)||(1346924-1347097)
chr6 (91-264)||(1354757-1354930)
chr6 (96-264)||(12221914-12222087)
chr6 (91-264)||(29355855-29356033)
chr6 (91-257)||(3815084-3815252)
chr6 (149-264)||(26097178-26097293)
chr6 (99-264)||(2166410-2166579)
chr6 (99-264)||(2178043-2178212)
chr6 (149-264)||(25557743-25557858)
chr6 (107-264)||(9161099-9161259)
chr6 (109-264)||(28007604-28007760)
chr6 (91-262)||(15866041-15866212)
chr6 (100-232)||(6024202-6024338)
chr6 (96-266)||(7947369-7947541)
chr6 (91-197)||(8409203-8409311)
chr6 (90-260)||(14975094-14975256)
chr6 (117-262)||(23240826-23240971)
chr6 (96-229)||(13905015-13905148)
chr6 (91-174)||(24734593-24734676)
chr6 (116-264)||(18277193-18277343)
chr6 (91-227)||(20400627-20400765)
chr6 (91-212)||(1941815-1941938)
chr6 (107-266)||(12889402-12889564)
chr6 (96-264)||(24097546-24097712)
chr6 (95-218)||(14553476-14553602)
chr6 (141-247)||(32579436-32579543)
chr6 (91-264)||(23930127-23930301)
chr6 (108-209)||(32728211-32728314)
chr6 (101-160)||(8417442-8417501)
chr6 (91-174)||(12063427-12063510)
chr6 (201-264)||(12885985-12886048)
chr6 (202-264)||(12892082-12892144)
chr6 (194-264)||(13267790-13267860)
chr6 (107-263)||(2755422-2755583)
chr6 (97-264)||(3116129-3116299)
chr6 (136-253)||(33138838-33138957)
chr6 (91-167)||(33922927-33923003)
chr6 (202-264)||(6808468-6808530)
chr6 (130-262)||(15865859-15865992)
chr6 (96-178)||(19649255-19649337)
chr6 (103-174)||(27855530-27855601)
chr6 (187-265)||(383759-383837)
chr6 (107-236)||(11849031-11849161)
chr6 (155-264)||(9671084-9671196)
chr6 (123-174)||(17432332-17432383)
chr6 (99-174)||(22967139-22967214)
chr6 (99-174)||(23821179-23821254)
chr6 (229-264)||(25997749-25997784)
chr6 (113-174)||(4136609-4136670)
chr6 (201-267)||(16895693-16895761)
[»] scaffold0168 (1 HSPs)
scaffold0168 (91-264)||(30539-30712)
[»] chr4 (95 HSPs)
chr4 (91-264)||(20224944-20225117)
chr4 (91-264)||(47528530-47528703)
chr4 (91-264)||(48598825-48598998)
chr4 (91-264)||(11054148-11054321)
chr4 (91-264)||(5648219-5648393)
chr4 (91-263)||(6430627-6430800)
chr4 (96-264)||(16408601-16408773)
chr4 (91-264)||(30639340-30639514)
chr4 (91-264)||(5306660-5306838)
chr4 (109-264)||(9832313-9832468)
chr4 (123-262)||(29207900-29208039)
chr4 (112-260)||(39077800-39077948)
chr4 (96-263)||(8473621-8473790)
chr4 (90-261)||(21646923-21647098)
chr4 (91-264)||(23501753-23501924)
chr4 (104-263)||(40915802-40915962)
chr4 (91-264)||(16911522-16911699)
chr4 (111-264)||(54175043-54175200)
chr4 (107-264)||(35567146-35567305)
chr4 (104-266)||(44363128-44363294)
chr4 (106-264)||(47443928-47444092)
chr4 (91-264)||(13256399-13256572)
chr4 (111-234)||(17043424-17043549)
chr4 (96-253)||(30496333-30496490)
chr4 (106-254)||(19027823-19027973)
chr4 (149-264)||(20639658-20639776)
chr4 (91-212)||(14590797-14590921)
chr4 (135-264)||(10277757-10277886)
chr4 (109-265)||(30690175-30690340)
chr4 (117-242)||(25463108-25463235)
chr4 (91-264)||(30352580-30352766)
chr4 (91-264)||(20405053-20405224)
chr4 (91-250)||(37494811-37494972)
chr4 (149-263)||(7909281-7909397)
chr4 (103-264)||(14983806-14983969)
chr4 (151-264)||(25629069-25629184)
chr4 (96-261)||(54966987-54967151)
chr4 (91-253)||(54730209-54730376)
chr4 (97-242)||(49938615-49938759)
chr4 (151-242)||(49796818-49796910)
chr4 (91-174)||(17315390-17315473)
chr4 (114-220)||(41018838-41018945)
chr4 (96-228)||(47441566-47441699)
chr4 (91-264)||(55766466-55766641)
chr4 (107-264)||(20908636-20908797)
chr4 (109-266)||(32478790-32478942)
chr4 (194-264)||(38786674-38786744)
chr4 (143-259)||(21489099-21489218)
chr4 (94-189)||(42164224-42164319)
chr4 (108-242)||(3580862-3580994)
chr4 (174-266)||(20225119-20225213)
chr4 (114-241)||(7385499-7385628)
chr4 (96-248)||(30581481-30581636)
chr4 (116-240)||(32629293-32629418)
chr4 (107-211)||(487187-487294)
chr4 (155-264)||(51865038-51865149)
chr4 (91-174)||(10660364-10660447)
chr4 (91-174)||(10874509-10874592)
chr4 (109-264)||(23580208-23580365)
chr4 (107-242)||(39029082-39029220)
chr4 (91-264)||(55830721-55830896)
chr4 (96-203)||(25343153-25343261)
chr4 (119-264)||(7038041-7038187)
chr4 (143-260)||(9987838-9987957)
chr4 (91-161)||(5313099-5313169)
chr4 (96-174)||(54640431-54640508)
chr4 (203-264)||(32484307-32484368)
chr4 (107-172)||(43035224-43035289)
chr4 (107-171)||(12257688-12257752)
chr4 (202-265)||(38755907-38755970)
chr4 (107-177)||(41549358-41549428)
chr4 (200-265)||(11394923-11394988)
chr4 (200-265)||(11404650-11404715)
chr4 (96-261)||(36589710-36589876)
chr4 (171-265)||(48327762-48327858)
chr4 (91-162)||(20373898-20373969)
chr4 (202-264)||(33836487-33836549)
chr4 (171-264)||(36816384-36816478)
chr4 (203-265)||(40553936-40553998)
chr4 (202-266)||(25388249-25388313)
chr4 (200-260)||(28494222-28494282)
chr4 (173-264)||(2813169-2813263)
chr4 (96-190)||(49938513-49938608)
chr4 (214-264)||(35532077-35532127)
chr4 (109-170)||(7227710-7227771)
chr4 (91-128)||(18969701-18969738)
chr4 (96-201)||(51420539-51420646)
chr4 (204-264)||(19027986-19028046)
chr4 (171-218)||(12711495-12711542)
chr4 (203-266)||(44718641-44718704)
chr4 (91-129)||(29879634-29879672)
chr4 (96-158)||(50856344-50856405)
chr4 (214-264)||(56322985-56323035)
chr4 (122-210)||(10379997-10380086)
chr4 (239-267)||(5313068-5313096)
[»] chr2 (72 HSPs)
chr2 (91-264)||(9671140-9671314)
chr2 (91-264)||(21779261-21779434)
chr2 (91-266)||(23397726-23397901)
chr2 (91-264)||(8455316-8455491)
chr2 (91-266)||(14530278-14530457)
chr2 (91-264)||(10543658-10543835)
chr2 (91-264)||(25249738-25249912)
chr2 (91-254)||(12023929-12024093)
chr2 (102-264)||(17667973-17668137)
chr2 (101-264)||(24200623-24200790)
chr2 (91-264)||(11514396-11514570)
chr2 (102-264)||(17623535-17623699)
chr2 (91-264)||(27573581-27573755)
chr2 (122-264)||(10546153-10546298)
chr2 (122-264)||(14444720-14444863)
chr2 (91-264)||(17896219-17896395)
chr2 (91-264)||(25079717-25079893)
chr2 (91-228)||(22371017-22371153)
chr2 (107-264)||(21377074-21377232)
chr2 (97-264)||(39914306-39914475)
chr2 (91-264)||(5840988-5841165)
chr2 (91-252)||(19977726-19977889)
chr2 (149-264)||(36871511-36871626)
chr2 (116-264)||(25641487-25641636)
chr2 (96-261)||(4516354-4516520)
chr2 (91-267)||(14544023-14544204)
chr2 (109-219)||(5450263-5450376)
chr2 (106-266)||(40416869-40417031)
chr2 (96-260)||(24859992-24860156)
chr2 (108-248)||(99281-99421)
chr2 (151-264)||(40762234-40762349)
chr2 (91-199)||(7214494-7214604)
chr2 (99-264)||(26684620-26684789)
chr2 (96-242)||(32781310-32781457)
chr2 (91-201)||(17705455-17705567)
chr2 (171-264)||(25632551-25632644)
chr2 (96-264)||(44643488-44643658)
chr2 (111-266)||(17380236-17380391)
chr2 (120-252)||(19614981-19615116)
chr2 (107-226)||(23145736-23145857)
chr2 (107-226)||(23557526-23557647)
chr2 (103-184)||(44604826-44604908)
chr2 (109-252)||(31158451-31158598)
chr2 (107-242)||(33795261-33795398)
chr2 (152-252)||(30826058-30826158)
chr2 (107-220)||(44521417-44521532)
chr2 (107-174)||(29419981-29420048)
chr2 (135-263)||(13245096-13245217)
chr2 (91-133)||(27466263-27466305)
chr2 (127-254)||(17471544-17471675)
chr2 (204-264)||(34080176-34080236)
chr2 (203-262)||(41409936-41409995)
chr2 (125-208)||(2003592-2003678)
chr2 (209-265)||(8575975-8576031)
chr2 (140-264)||(15296406-15296533)
chr2 (116-252)||(31821355-31821491)
chr2 (91-131)||(39189556-39189596)
chr2 (203-263)||(40579750-40579810)
chr2 (201-264)||(23488555-23488618)
chr2 (96-162)||(35017783-35017849)
chr2 (130-219)||(12315697-12315787)
chr2 (194-256)||(31523296-31523358)
chr2 (214-260)||(39189508-39189554)
chr2 (108-174)||(45235910-45235976)
chr2 (198-251)||(4794871-4794924)
chr2 (216-264)||(22371199-22371247)
chr2 (116-174)||(4852306-4852364)
chr2 (194-248)||(24059012-24059066)
chr2 (108-169)||(34752759-34752820)
chr2 (171-252)||(39499242-39499323)
chr2 (216-260)||(124918-124962)
chr2 (152-207)||(30864474-30864530)
[»] chr3 (78 HSPs)
chr3 (91-264)||(1217072-1217245)
chr3 (91-263)||(22122918-22123090)
chr3 (91-265)||(39203498-39203672)
chr3 (91-264)||(40272812-40272987)
chr3 (91-263)||(7696893-7697060)
chr3 (91-264)||(13730602-13730779)
chr3 (138-264)||(31592878-31593004)
chr3 (91-264)||(13628790-13628968)
chr3 (93-264)||(26869691-26869863)
chr3 (91-264)||(29366720-29366897)
chr3 (91-262)||(8247688-8247864)
chr3 (91-264)||(46421034-46421212)
chr3 (91-264)||(52926219-52926385)
chr3 (91-264)||(16735423-16735597)
chr3 (91-263)||(22609749-22609921)
chr3 (91-264)||(12914035-12914210)
chr3 (108-264)||(34420643-34420802)
chr3 (158-264)||(15797271-15797377)
chr3 (96-262)||(26573115-26573282)
chr3 (91-253)||(6411833-6411996)
chr3 (91-191)||(10870025-10870126)
chr3 (117-264)||(516417-516569)
chr3 (91-264)||(5173719-5173896)
chr3 (159-264)||(26292382-26292487)
chr3 (167-264)||(34771364-34771461)
chr3 (107-264)||(53996565-53996725)
chr3 (99-212)||(4495716-4495831)
chr3 (149-264)||(54484730-54484848)
chr3 (91-247)||(9607185-9607345)
chr3 (111-242)||(30928169-30928302)
chr3 (96-211)||(45620881-45620998)
chr3 (112-260)||(7942993-7943143)
chr3 (137-265)||(10795422-10795554)
chr3 (96-254)||(45948848-45949010)
chr3 (141-264)||(14986989-14987116)
chr3 (108-264)||(25944468-25944627)
chr3 (90-264)||(25517170-25517349)
chr3 (120-248)||(33926094-33926224)
chr3 (152-264)||(49013473-49013589)
chr3 (155-266)||(45786212-45786327)
chr3 (124-252)||(54374357-54374488)
chr3 (171-262)||(353351-353444)
chr3 (96-174)||(35417904-35417981)
chr3 (105-212)||(33235526-33235637)
chr3 (120-212)||(54032611-54032705)
chr3 (111-198)||(39211992-39212081)
chr3 (155-228)||(47624088-47624162)
chr3 (151-266)||(31831241-31831345)
chr3 (107-181)||(53062036-53062112)
chr3 (204-264)||(30452892-30452952)
chr3 (91-189)||(12525392-12525489)
chr3 (198-264)||(24851301-24851367)
chr3 (120-220)||(45139520-45139624)
chr3 (107-260)||(19731000-19731155)
chr3 (91-204)||(21875002-21875111)
chr3 (189-264)||(24578007-24578082)
chr3 (141-272)||(55401208-55401342)
chr3 (96-254)||(829452-829611)
chr3 (149-264)||(50624953-50625070)
chr3 (115-212)||(8410919-8411016)
chr3 (107-265)||(28904941-28905101)
chr3 (158-265)||(9276313-9276420)
chr3 (149-212)||(31904909-31904974)
chr3 (107-260)||(44403559-44403715)
chr3 (128-209)||(52428532-52428616)
chr3 (107-212)||(19751576-19751683)
chr3 (189-264)||(24577917-24577992)
chr3 (91-174)||(26782348-26782431)
chr3 (142-250)||(43114882-43114994)
chr3 (218-264)||(6242285-6242331)
chr3 (219-264)||(40390353-40390398)
chr3 (204-264)||(14266372-14266431)
chr3 (149-214)||(31672733-31672800)
chr3 (198-242)||(46169989-46170033)
chr3 (216-264)||(47624208-47624256)
chr3 (209-264)||(10484616-10484671)
chr3 (96-174)||(43956552-43956629)
chr3 (109-203)||(1121286-1121382)
[»] scaffold0187 (4 HSPs)
scaffold0187 (91-262)||(10052-10223)
scaffold0187 (91-262)||(20380-20551)
scaffold0187 (91-147)||(8905-8961)
scaffold0187 (91-147)||(19233-19289)
[»] chr5 (62 HSPs)
chr5 (91-264)||(8169984-8170157)
chr5 (91-264)||(35710273-35710446)
chr5 (118-264)||(32703411-32703557)
chr5 (91-264)||(41014279-41014453)
chr5 (91-264)||(38879541-38879718)
chr5 (91-264)||(24448850-24449025)
chr5 (91-264)||(4619104-4619281)
chr5 (91-264)||(43334162-43334339)
chr5 (91-265)||(1565391-1565567)
chr5 (149-261)||(7368416-7368528)
chr5 (91-264)||(22861669-22861841)
chr5 (91-260)||(27328712-27328885)
chr5 (91-192)||(37024628-37024729)
chr5 (96-264)||(19142943-19143111)
chr5 (114-264)||(1405170-1405322)
chr5 (91-266)||(22187245-22187424)
chr5 (170-267)||(34154811-34154908)
chr5 (140-266)||(13801765-13801895)
chr5 (91-241)||(2838738-2838890)
chr5 (96-263)||(12006329-12006500)
chr5 (155-266)||(7097758-7097870)
chr5 (96-255)||(39301089-39301249)
chr5 (135-255)||(43574610-43574732)
chr5 (103-242)||(22600426-22600567)
chr5 (91-266)||(30006285-30006462)
chr5 (156-266)||(16880645-16880757)
chr5 (150-263)||(20135623-20135740)
chr5 (91-174)||(23974741-23974823)
chr5 (107-255)||(208936-209086)
chr5 (107-264)||(28516433-28516593)
chr5 (151-264)||(29334415-29334531)
chr5 (115-254)||(1850624-1850764)
chr5 (205-265)||(30877563-30877623)
chr5 (189-264)||(16957374-16957449)
chr5 (91-203)||(31299592-31299705)
chr5 (152-267)||(5873319-5873435)
chr5 (109-242)||(24323727-24323862)
chr5 (109-242)||(24360351-24360486)
chr5 (205-264)||(16028624-16028683)
chr5 (94-264)||(3771305-3771474)
chr5 (116-212)||(22907917-22908014)
chr5 (111-255)||(34074573-34074717)
chr5 (131-220)||(41425948-41426039)
chr5 (149-266)||(12575658-12575779)
chr5 (202-264)||(25622533-25622595)
chr5 (217-262)||(11462913-11462958)
chr5 (96-161)||(17419879-17419944)
chr5 (96-157)||(39079875-39079935)
chr5 (126-174)||(22025538-22025586)
chr5 (123-203)||(42924895-42924977)
chr5 (96-174)||(10634238-10634315)
chr5 (179-264)||(11657699-11657785)
chr5 (223-263)||(19438760-19438800)
chr5 (91-123)||(41956892-41956924)
chr5 (201-252)||(4654427-4654478)
chr5 (171-254)||(9794388-9794471)
chr5 (193-264)||(10943845-10943915)
chr5 (91-129)||(19438709-19438747)
chr5 (106-148)||(31362453-31362495)
chr5 (214-264)||(32354212-32354262)
chr5 (201-261)||(21784335-21784395)
chr5 (204-260)||(39801591-39801647)
[»] scaffold0223 (1 HSPs)
scaffold0223 (96-265)||(11097-11265)
[»] scaffold0258 (1 HSPs)
scaffold0258 (91-264)||(13024-13198)
[»] scaffold0057 (4 HSPs)
scaffold0057 (96-264)||(46796-46966)
scaffold0057 (91-264)||(24772-24942)
scaffold0057 (151-264)||(43679-43793)
scaffold0057 (108-154)||(46995-47041)
[»] scaffold0049 (1 HSPs)
scaffold0049 (91-266)||(58937-59116)
[»] scaffold0015 (1 HSPs)
scaffold0015 (152-264)||(48634-48746)
[»] scaffold1176 (1 HSPs)
scaffold1176 (100-266)||(1585-1751)
[»] scaffold0311 (1 HSPs)
scaffold0311 (96-264)||(10775-10945)
[»] scaffold0005 (1 HSPs)
scaffold0005 (91-212)||(226457-226581)
[»] scaffold0036 (1 HSPs)
scaffold0036 (90-212)||(35069-35195)
[»] scaffold0180 (1 HSPs)
scaffold0180 (177-264)||(24133-24220)
[»] scaffold0018 (1 HSPs)
scaffold0018 (96-264)||(72867-73031)
[»] scaffold0254 (1 HSPs)
scaffold0254 (99-227)||(4125-4258)
[»] scaffold0024 (1 HSPs)
scaffold0024 (91-159)||(83835-83903)
[»] scaffold0954 (1 HSPs)
scaffold0954 (149-265)||(3562-3680)
[»] scaffold0031 (1 HSPs)
scaffold0031 (99-174)||(43097-43172)
[»] scaffold0116 (1 HSPs)
scaffold0116 (105-174)||(8865-8934)
[»] scaffold0194 (1 HSPs)
scaffold0194 (91-162)||(24624-24695)
[»] scaffold0167 (1 HSPs)
scaffold0167 (96-242)||(23569-23712)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 5e-88; HSPs: 94)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 270 - 454
Target Start/End: Complemental strand, 35417926 - 35417742
Alignment:
270 tatagagtatccacataccaccgtttagtagtgattaatcattgtcagaacttgttggacacataaggttaactctctcatcggatcatattgctaaatt 369  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||    
35417926 tatagagtatccatataccaccgtttagtagtgattaatcattgtcagaatttgttggacacataaggttaactctctcattggatcatattgctaaatt 35417827  T
370 actaatagatggtccgcgggtaagtggttaaggagtttaccatggctatttaagttcaacaaatgcattctgaatttctgataaa 454  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
35417826 actaatagatggtccgcgggtaagtggttgaggagtttaccatggctatttaagttcaacaaatgcattccgaatttctgataaa 35417742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 34725271 - 34725098
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
34725271 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 34725172  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || |||||| |||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
34725171 acaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 34725098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 38478455 - 38478282
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||||||| ||||| |||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||    
38478455 taaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaacagggtaaggctgcgt 38478356  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || |||||||||||||||| || ||||| || |||||||||||| |||||||||||||||||||||||||||||    
38478355 acaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 38478282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 46248128 - 46247953
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||  ||||||||||||||||||    
46248128 taaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgc 46248029  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| ||||| |||||||||||||||    
46248028 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttt 46247953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 32632731 - 32632557
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||    
32632731 taaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 32632632  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| ||||||| ||||||||||||| |||||||  |||||||| |||| ||||||    
32632631 tacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttcccttt 32632557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 19414422 - 19414595
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||| || |||||||||||||||||| ||||||||| ||||||||||||| |||| |||| |||||||| ||||||||||| |||| ||||||    
19414422 taaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaacaggttaaggctgcgt 19414521  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
19414522 acaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcccttt 19414595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 91 - 260
Target Start/End: Complemental strand, 45812710 - 45812541
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||| ||||||||||||||||||||||||| ||||| ||||||| ||||| |||||| ||||||||||||| |||||||| |||| |    
45812710 taaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaagagggtaaggctgcat 45812611  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    || ||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||    
45812610 acaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 91 - 252
Target Start/End: Original strand, 47214494 - 47214655
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||| ||||||||||||||  |||||    
47214494 taactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaacagggtaaggttgcgt 47214593  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    || ||||||||||||||||||| |||||||  |||||||||||| |||||||||||||||||    
47214594 acaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc 47214655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 91 - 261
Target Start/End: Original strand, 46991787 - 46991959
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| |||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||| ||||||||||  ||||||||||||| |||     
46991787 taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgt 46991886  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    |||| ||||||| ||||||||||| |||||||| ||||||| |||||||||||| ||||||||||||||||||    
46991887 gtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 14617021 - 14617196
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa--aacagggtaagactgc 188  Q
    |||| |||||||||| ||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||  |||| ||||||  |||    
14617021 taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgc 14617120  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||  |||||||| |||||||||||| ||||||| |||||||||||||| ||||||    
14617121 gtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttacccttt 14617196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 30395903 - 30395726
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||  || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||    
30395903 taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 30395804  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||| ||||||||||    
30395803 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 30395726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 122 - 264
Target Start/End: Complemental strand, 35253329 - 35253187
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccg 221  Q
    ||||||||||||  |||||||||||| |||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||    
35253329 atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccg 35253230  T
222 aaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     |||||||||||| ||||||||||||||||||| |||||||||    
35253229 gaccctgcatatgcgggagctctagtgcaccggattgcccttt 35253187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 12127010 - 12126837
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||||||| |||||||||||||||||| | ||||| |||||||||| || | ||||||||||| ||||||||||||||||||||| ||||||    
12127010 taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaacagggtaaggctgcgt 12126911  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||| ||||||| |||||||| |||||||||||| ||||||| |||||||| | ||||||||||    
12126910 acaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgcccttt 12126837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 18944626 - 18944804
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||  |||||||||||||||||||||  ||||||||||||| ||||    
18944626 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 18944725  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagc-tctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| |||| |||||| | |||||||||||||||||||||    
18944726 gtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt 18944804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 20004267 - 20004090
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| |||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||| ||||  |||||| |||||| ||||    
20004267 taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgc 20004168  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||  |||| ||||||| ||||||| |||||||||||||||||||||    
20004167 gtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt 20004090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 102 - 264
Target Start/End: Complemental strand, 41319970 - 41319806
Alignment:
102 caactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacac 199  Q
    |||||||||||||||||||||||||||||||| ||||| |||| || |||||||||||| |||||||||||||  ||||||||| |||||||| ||||||    
41319970 caactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 41319871  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| |||||| |||||||||||||| |||||| ||||| |  ||||||| ||||||||||||    
41319870 caaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgcccttt 41319806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 100 - 259
Target Start/End: Complemental strand, 23768486 - 23768325
Alignment:
100 cgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatac 197  Q
    ||||||||||||||||||||||||||||||| || ||||| ||||||| || |||||||||||||||||||  ||||||||||||| |||||||| ||||    
23768486 cgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatac 23768387  T
198 accaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgc 259  Q
    ||||||||||||||| |||||||  ||||||| |||| ||||||| ||||||| ||| ||||    
23768386 accaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 10668203 - 10668385
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgt-----gactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaag 183  Q
    |||| ||||||||||||||||||||||||||||||     |||||||| ||||||||||||| ||||||||||||||||||||||  |||||| ||||||    
10668203 taaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaag 10668302  T
184 actgcgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
      ||||||| ||||||||  ||||||||||| ||||||||  |||||| |||| ||||||| |||||||||||||||||||||    
10668303 gttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10668385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 102 - 264
Target Start/End: Original strand, 27474275 - 27474438
Alignment:
102 caactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacc 200  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||| || ||||||||| ||||||||| ||||||||| ||  |||||||| ||||||     
27474275 caactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacact 27474374  T
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||||||||||| |||||||| ||||||| |||| ||||||| ||||||||||| |||||||||    
27474375 gaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 27474438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 91 - 261
Target Start/End: Original strand, 45402078 - 45402251
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggt--aag-act 186  Q
    |||| |||||||||||||||||||||||||||||||| || || || |||||||||| |||||||||||||||||||||| ||||||||||  |||  ||    
45402078 taaccttggcgcaactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttcaagttct 45402176  T
187 gcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    |||||| ||||||||||||||||||| |||||||  ||||||| |||| ||||||| ||||||||||||||||||    
45402177 gcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 96 - 242
Target Start/End: Complemental strand, 18724714 - 18724567
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||| ||||     
18724714 ttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtaca 18724616  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||||  |||||| |||||||| ||||| |||||| |||||||    
18724615 atacaccaaatcttgggaccccttcccggaccctacatatgcgggagct 18724567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 106 - 264
Target Start/End: Original strand, 27201645 - 27201807
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc--a 201  Q
    |||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||   |||||||||||| |||||||| |||||||  |    
27201645 tggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaa 27201744  T
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||||||| ||| ||| |||| ||||||| |||||||  ||||||||||||    
27201745 aatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgcccttt 27201807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 104 - 260
Target Start/End: Original strand, 6925096 - 6925254
Alignment:
104 actggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacca 201  Q
    ||||||||||||||||||||||||||| || ||||||||||||| ||||||||| ||||||||||||  |||| |||||||| ||||| || |||||||     
6925096 actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccg 6925195  T
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||||| ||||||||  |||||| |||| ||||||| |||||||||| ||||||    
6925196 aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgcc 6925254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 8197026 - 8197201
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| ||||||||| ||||||||||||||||||||||| ||||||||||||| |||||| ||  |||||||||||  |||||| |||||| || |    
8197026 taaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctac 8197125  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||  ||||||||||||| |||| ||||| || ||||||| ||||| |||||| ||||| |||||||||||||||    
8197126 gtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgcccttt 8197201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 96 - 242
Target Start/End: Original strand, 11596502 - 11596648
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtacca 194  Q
    |||||||||| |||||||| | |||||||||||||||||||||||||||||| |||| |||||| |||||||||| ||||||||||||| |||||||  |    
11596502 ttggcgcaac-ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggtaaggctgcgtataa 11596600  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||||||||||| |||||| | ||||||| |||| |||||||    
11596601 tacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagct 11596648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 18742136 - 18741957
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcct-ggaaacagcctcttgtgt---aaaacagggtaagact 186  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||| | |||||||| || |||| |   ||||||||||||| ||    
18742136 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggct 18742037  T
187 gcgtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| |||||||  |||||||||||| |||||||  ||||||| |||| | ||||| |||||||||||||| ||||||    
18742036 gcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttt 18741957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 6983978 - 6983811
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccat 195  Q
    ||||||||| ||||||||||||||||| |||||||||| ||||| ||||||| |||||||||||||||| | |  |||||||||||||  ||||||| ||    
6983978 ttggcgcaa-tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcgtataaaaaacagggtaagtatgcgtacaat 6983880  T
196 acaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||| |||| ||| ||||||| || |  |||||| | |||||||||| ||||||||    
6983879 acaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgcccttt 6983811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 91 - 229
Target Start/End: Complemental strand, 22930242 - 22930104
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||| |||||| |||||||||||||  || |    
22930242 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggtaaggttgtg 22930143  T
190 taccatacaccaaatggtgggactccttcccgaaccctgc 229  Q
     || ||||||||||||||||||| |||||| | |||||||    
22930142 -acaatacaccaaatggtgggaccccttcctggaccctgc 22930104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 5 - 92
Target Start/End: Complemental strand, 35418010 - 35417923
Alignment:
5 gcaatcctgtagtaaataaattatttaataatcaccaaaggctgcatatttccctttcacatccttctctttgttttgtcaacttata 92  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
35418010 gcaatcctgtagtaaataagttatttaataatcaccaaaggttgcatatttccctttcacatccttctctttattttgtcaacttata 35417923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 96 - 254
Target Start/End: Complemental strand, 2435956 - 2435796
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||| |||||  |||| |||||||| ||||||||     
2435956 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtaca 2435858  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    ||||||| |||||||||||| |||| ||| ||||| |  ||| ||||||| |||||||||||    
2435857 atacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg 2435796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 96 - 234
Target Start/End: Original strand, 20036209 - 20036349
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa---acagggtaagactgcgtac 192  Q
    ||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||  ||||||||||||   | ||||||||| ||||| |    
20036209 ttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttc 20036307  T
193 catacaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
     |||||||||||||||| || |||||||| ||||||| ||||    
20036308 aatacaccaaatggtggaaccccttcccggaccctgcgtatg 20036349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 124 - 264
Target Start/End: Original strand, 35005139 - 35005283
Alignment:
124 gtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa--tggtgggactccttcc 219  Q
    |||||||||| ||||||||||||| || || ||||||||||||||||||||  ||||||||| |||| ||| ||||||||||  ||||||||| ||||||    
35005139 gtgactgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcc 35005238  T
220 cgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||| |||| ||| ||| |||||||||||||||||||||    
35005239 cggaccctgcgtatgcgggcgctttagtgcaccgggttgcccttt 35005283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 149 - 264
Target Start/End: Complemental strand, 31382330 - 31382214
Alignment:
149 tcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    |||||||||||||||||||||||||| |||| |||| |||||||| ||||||||||||||||||| |||||| | |||||||||||| ||||||| || |    
31382330 tcctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttact 31382231  T
248 gcaccgggttgcccttt 264  Q
    | |||||||||||||||    
31382230 gtaccgggttgcccttt 31382214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 35117927 - 35117765
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacc--aa 202  Q
    |||||||||||||||| |||||||||| ||||||||||||| ||||||||| |||||||||||||||  |||||||||| ||| |||| |||||||  ||    
35117927 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa 35117828  T
203 atggtgggactccttcccgaaccctgcat-atgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| |||||| |||||||| ||||||| | |||  |||||| |||||||||||| | ||||||    
35117827 atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt 35117765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 171 - 265
Target Start/End: Original strand, 4349703 - 4349797
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||| |||||||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| ||||||||||||||||||||||    
4349703 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 4349797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 108 - 243
Target Start/End: Complemental strand, 25468421 - 25468284
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatg 205  Q
    |||||||||||||||||||| ||||| |||| |||||||| ||||||||||| ||||||||||||||  |||||||||  ||||||| ||||||||||||    
25468421 gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatg 25468322  T
206 gtgggactccttcccgaaccctgcatatgtgggagctc 243  Q
    || ||||  ||||||  ||||||| |||| ||||||||    
25468321 gttggacctcttcccagaccctgcgtatgcgggagctc 25468284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 96 - 210
Target Start/End: Complemental strand, 4430196 - 4430080
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||| |||||||||||||||||||||||||| || |||||||||| || || || ||||||  ||||||||  ||||||||||||||||||||||     
4430196 ttggcgcagctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtaca 4430097  T
194 atacaccaaatggtggg 210  Q
    |||||||||||||||||    
4430096 atacaccaaatggtggg 4430080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 9939443 - 9939622
Alignment:
91 taacattggcgcaactggtaaa-gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta--aaacagggtaagactg 187  Q
    |||| |||||||||| |||||| ||||||||||||||||||||| |||||| |||||| ||||||||||| |||||||| ||  ||||| ||||||  ||    
9939443 taaccttggcgcaaccggtaaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttg 9939542  T
188 cgtaccatacacc--aaatggtggga-ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| | |||||||  ||||||||||| | ||||| || ||||||| |||| ||||||| |||||||||||||| ||||||    
9939543 cgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttacccttt 9939622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 96 - 212
Target Start/End: Original strand, 33222972 - 33223090
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtacca 194  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||| || || || ||||||||||||||||||| ||||||||| |||  ||||||| |    
33222972 ttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaa 33223071  T
195 tacacc-aaatggtgggac 212  Q
    |||||| ||||||||||||    
33223072 tacaccaaaatggtgggac 33223090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 107 - 266
Target Start/End: Complemental strand, 10378884 - 10378733
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatgg 206  Q
    |||||||||||||||| |||||||||| || |||||||||| |||||||||        || | ||||||||||||| |||||||| |||||||||||||    
10378884 ggtaaagttgttgtcacgtgactgaaaggttacgggttcaagtcctggaaag-------tgag-aaaacagggtaaggctgcgtacaatacaccaaatgg 10378793  T
207 tgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||||| |||||  | |||||||||||| ||||||| |||||||||||| ||||| ||||    
10378792 tgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgcccattat 10378733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 96 - 234
Target Start/End: Complemental strand, 19932922 - 19932783
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||||||||||||||||||||||||||||||| |||| |||||||| |  |||| ||| ||| ||||||  ||||||||||||| ||||||||     
19932922 ttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagt--tggatacaacct-ttgtgtaaaaaacagggtaaggctgcgtaca 19932826  T
194 atacacc--aaatggtgggactccttcccgaaccctgcatatg 234  Q
    |||||||  |||||||||||| |||||||| ||||||| ||||    
19932825 atacaccaaaaatggtgggaccccttcccggaccctgcgtatg 19932783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 107 - 250
Target Start/End: Complemental strand, 17470505 - 17470361
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||||||||||||| |||||||||  |||| |||||||| |||| |||||||||||||||||  ||||||||||||| |||||||| ||||||| |||    
17470505 ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaa 17470406  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    | ||||||| | |||| ||  ||||| |||||||||||| |||||||    
17470405 tagtgggacccgttcctga--cctgcgtatgtgggagctttagtgca 17470361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 108 - 252
Target Start/End: Original strand, 19701570 - 19701717
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaat 204  Q
    |||||||||||||| |||||||||||||||||||||| || || || ||||||||||||||||  |||||  ||||||  || |||| ||||||| ||||    
19701570 gtaaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaat 19701669  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||| | |||||||| ||||||| |||| ||||||| |||||||||    
19701670 ggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc 19701717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 108 - 255
Target Start/End: Complemental strand, 44485267 - 44485119
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacaccaaatg 205  Q
    |||||||||||||||||||| ||||| ||||||||||  | ||||||||||| || ||||||||||  ||| |||||| |||||||| ||||||||||||    
44485267 gtaaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatg 44485168  T
206 gtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    || |||| |||||||| | ||| | |||| ||||||| | ||||||||||    
44485167 gttggaccccttcccggatcctacgtatgcgggagct-ttgtgcaccggg 44485119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 50811928 - 50812098
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtac 192  Q
    |||||||||| |||||||||||||||| |||||||||| |||||||  |||  ||||||||||||| ||||||||   |||||||||||||  |||||||    
50811928 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtac 50812026  T
193 catacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||||||| ||||||| |||| ||||||||  |||||| |||| ||||||| || ||||| ||| ||||||||    
50812027 aatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttt 50812098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 96 - 262
Target Start/End: Complemental strand, 15511320 - 15511150
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcg--ta 191  Q
    ||||||||| ||||||||||||||| ||||| |||||| |||||   || || |||||||||| |||||||||||  ||||||||||||| |||||  ||    
15511320 ttggcgcaa-tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggata 15511222  T
192 ccatacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    | ||||||| ||||||||| || |||||| | ||||||| |||||| ||||| |||||||||||| ||||||    
15511221 caatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct 15511150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 96 - 209
Target Start/End: Complemental strand, 34679388 - 34679274
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||| |||||||||||||||||| ||||  |||| | |||| |||||| ||||||||||  ||||||||||||||||||||||     
34679388 ttggcgcaac-ggtaaagttattgtcatgtgactgaaatatcacatgttccattcctagaaacaacctcttgtgtaaaaaacagggtaagactgcgtact 34679290  T
194 atacaccaaatggtgg 209  Q
    ||||| ||||||||||    
34679289 atacatcaaatggtgg 34679274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 96 - 260
Target Start/End: Original strand, 22327088 - 22327250
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| || |||||||||||||||||||||||| ||| ||||||||| ||||||||||| ||||||||||  ||||||||||||| ||| ||||     
22327088 ttggcgcaac-ggcaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacg 22327186  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    || |||| ||||||||||     ||||||||| |||  |||| ||||||| | |||||||||| ||||    
22327187 atgcaccaaaatggtggg----gttcccgaactctgtgtatgcgggagctttggtgcaccgggctgcc 22327250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 150 - 264
Target Start/End: Original strand, 23796507 - 23796623
Alignment:
150 cctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    |||||||||||||||||||||||||  ||  |||||  ||||||| ||||||||||||||| ||| |||||||  ||||||||||||  |||||| ||||    
23796507 cctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagt 23796606  T
248 gcaccgggttgcccttt 264  Q
    |||||||| ||||||||    
23796607 gcaccgggctgcccttt 23796623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 15505632 - 15505700
Alignment:
174 acagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||    
15505632 acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct 15505700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 25290146 - 25290231
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaa--acagcctcttgtgtaaaa 174  Q
    |||| |||||||||| ||||||||||||||||||||||||||| |||||| |||||| || |||||  ||||||||||||||||||    
25290146 taaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaa 25290231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 107 - 202
Target Start/End: Complemental strand, 50760385 - 50760288
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtg--taaaacagggtaagactgcgtaccatacaccaa 202  Q
    |||||||| |||||||||||||||| | ||||||||||||| ||||| |||||||||||||||  |||||| ||||||| |||||||  |||||||||    
50760385 ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacaccaa 50760288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 91 - 160
Target Start/End: Original strand, 34714606 - 34714675
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacag 160  Q
    |||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||| || |||||||||    
34714606 taaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacag 34714675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 108 - 261
Target Start/End: Complemental strand, 39215117 - 39214961
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtaccatacaccaaa-t 204  Q
    |||||||| |||||| |||||| ||| ||| |  |||||| | ||||||||| |||||||||||||| |  ||||||| |||||||| |||  ||||| |    
39215117 gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaat 39215018  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    |||||| | ||||||| |||||||| ||||||| |||| |||||||||||| |||||    
39215017 ggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc 39214961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 107 - 207
Target Start/End: Original strand, 52910216 - 52910319
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||||||||| ||||| ||||||| || |||||||||||||||  ||   ||||||||||| ||||| |||| ||||||| ||    
52910216 ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgtacaatacacctaa 52910315  T
204 tggt 207  Q
    ||||    
52910316 tggt 52910319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 108 - 255
Target Start/End: Original strand, 23371124 - 23371271
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca-gggtaagactgcgtaccatacaccaaatgg 206  Q
    ||||||||||| ||   ||||||||| ||||||||||||| |||| ||||||||| |||| |||||| | ||| |||  || |||| ||||||||||||     
23371124 gtaaagttgttttcgcatgactgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgc 23371223  T
207 tgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    |||||| |||||| | ||||||| ||||||| |||| ||||||||||||    
23371224 tgggaccccttccag-accctgcgtatgtggtagctttagtgcaccggg 23371271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 171 - 264
Target Start/End: Complemental strand, 42304302 - 42304207
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaa--tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||  ||||||| |||||| |||  ||||||||| |||||||| ||||||| |||||||||||| ||||||||||| |||||||||    
42304302 aaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt 42304207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 2436052 - 2435985
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||||||||| |||||||||| ||||||||||||| ||||||||||| |||| |||||||||    
2436052 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaa 2435985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 96 - 260
Target Start/End: Original strand, 35019219 - 35019383
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||||||||||  ||||||||| ||||| | ||||| ||||| ||||| |||||||| |||||  |||  |||| |||| |||     
35019219 ttggcgcaac-ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcataca 35019317  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||| ||||||||| || ||||  ||||||| |||| | ||||| |||||||||||| ||||    
35019318 atacaccaattggtgggac-ccctcccagaccctgcgtatgcgagagctttagtgcaccgggctgcc 35019383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 50606498 - 50606561
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||||||| |||||||||||| ||||||| |||||||||||||||||||||    
50606498 aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 50606561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 91 - 152
Target Start/End: Original strand, 40424725 - 40424786
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcct 152  Q
    |||| |||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||    
40424725 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagtcct 40424786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 30682845 - 30682948
Alignment:
139 cgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgg 237  Q
    ||||||||||||||| ||| |||||||||||| |||||| ||||||| || ||| |||||| ||||||||||||| |||||||| ||| ||| |||| ||    
30682845 cgggttcaaatcctgaaaatagcctcttgtgtaaaaacaaggtaagattgtgta-catacaacaaatggtgggaccccttcccggaccgtgcgtatgcgg 30682943  T
238 gagct 242  Q
    |||||    
30682944 gagct 30682948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 149 - 268
Target Start/End: Complemental strand, 20169206 - 20169085
Alignment:
149 tcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctag 246  Q
    ||||| ||||| |||||||||||||| |   |||||||||| |||| |||| ||||  ||||||||||||||||| |||||||||||| ||||||| | |    
20169206 tcctgaaaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagcttttg 20169107  T
247 tgcaccgggttgccctttatag 268  Q
    ||  || || ||||||||||||    
20169106 tgtccctggctgccctttatag 20169085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 140 - 262
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
140 gggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtg 236  Q
    |||||||| || ||||||||||||||||||| ||||||||||||| |||| ||| |||||||  |||||||||  | || ||||| ||||||| |||| |    
22324925 gggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtcccg-accctgcgtatgcg 22325023  T
237 ggagctctagtgcaccgggttgccct 262  Q
    |||||| ||||||||| || ||||||    
22325024 ggagctttagtgcaccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 171 - 264
Target Start/End: Complemental strand, 1517404 - 1517311
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| | |||| |||||||| ||||||||| ||||||||| ||||| |  ||||||| ||||  |||||| |||||||||||||||||||||    
1517404 aaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcccttt 1517311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 118 - 210
Target Start/End: Complemental strand, 31272522 - 31272429
Alignment:
118 tgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtggg 210  Q
    ||||| |||||||||| ||||| ||||||| ||||||||||| |||||||||| |||||| |||||| ||||||||   ||| |||||||||||    
31272522 tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg 31272429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 150 - 255
Target Start/End: Complemental strand, 34149076 - 34148969
Alignment:
150 cctggaaacagcctcttgtgta--aaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    ||||||||||||||||||||||  ||| ||||||||  ||||||| | | ||||||||||| ||| |||||| | ||||||||||||  ||||| |||||    
34149076 cctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagcgctagt 34148977  T
248 gcaccggg 255  Q
    ||| ||||    
34148976 gcaacggg 34148969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 172 - 264
Target Start/End: Original strand, 43768205 - 43768297
Alignment:
172 aaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||| ||| ||||||||| ||||||||| |||||||  ||||||| |||  ||||||| || ||||||||| ||||||||    
43768205 aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt 43768297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 45264542 - 45264411
Alignment:
124 gtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa-tggtgggactccttccc 220  Q
    |||| ||||| |||||  |||||| ||||||||||| ||||||||| ||||  ||| ||||| ||| || | |||||||||| ||||||||| ||||| |    
45264542 gtgattgaaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctc 45264443  T
221 gaaccctgcatatgtgggagctctagtgcacc 252  Q
      |||||||||||| ||||||| |||||||||    
45264442 agaccctgcatatgcgggagctttagtgcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 91 - 207
Target Start/End: Original strand, 24564327 - 24564445
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||  ||||||||| |||| ||||| ||||| ||| | | ||||| || |||||||| ||||||||||  |||||||||||||  |||    
24564327 taaccttggcgcaaccagtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgc 24564426  T
189 gtaccatacaccaaatggt 207  Q
    |||| || |||||||||||    
24564427 gtacaattcaccaaatggt 24564445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 31442483 - 31442396
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggtt 257  Q
    |||||||||||||  ||||||| |||||||||| ||||||||| |||||||| || |||  |||||||||||| | ||||||||||||    
31442483 aaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt 31442396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 197 - 259
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
197 caccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgc 259  Q
    |||||||||||||||| |||||||| ||||||| |||| |||||||  |||||||||||||||    
4587630 caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc 4587568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 171 - 264
Target Start/End: Complemental strand, 20999943 - 20999850
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| || ||| |||||||| |||||||||||| |||| | |||||| | ||||||| || | ||||||| |||||||||||| ||||||||    
20999943 aaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgcccttt 20999850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 22151495 - 22151568
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa 172  Q
    ||||||||| ||||||||||||||| |||||| || ||||  ||||||| | |||||||||||||||| |||||    
22151495 gcgcaactgataaagttgttgtcatctgactgtaaggtcataggttcaagttctggaaacagcctcttatgtaa 22151568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 91 - 212
Target Start/End: Complemental strand, 18335463 - 18335340
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| ||||||||| || ||||||| |||||||||| |||||| |||||  ||| || |||||||||||| ||||||| |||||   |||||||   |||    
18335463 taaccttggcgcaagtgataaagtttttgtcatgtgtctgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagttgc 18335364  T
189 gtaccatacaccaaatggtgggac 212  Q
    |||| ||||| |||||| ||||||    
18335363 gtacaatacatcaaatgatgggac 18335340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 171 - 227
Target Start/End: Complemental strand, 21910742 - 21910686
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccct 227  Q
    |||| ||||||||  ||||||| ||||||||||||||||||| ||||||||||||||    
21910742 aaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccct 21910686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 27136811 - 27136696
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||||||||||||| |||| || || | |||| |||||| | |||| |||| ||||||||||  |||||| ||||||  ||||||| ||||||| |||    
27136811 ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaa 27136712  T
204 tggtgggactccttcc 219  Q
    ||||||||| ||||||    
27136711 tggtgggaccccttcc 27136696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 10163742 - 10163825
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||||||| |||||||||||||||||| || |||||| ||  ||| || | ||| ||||| |||||| |||||||    
10163742 taacattggcgcaactgataaagttgttgtcatgtggctaaaatgttacaagtttaagttctgaaaacaacctcttatgtaaaa 10163825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 119 - 264
Target Start/End: Complemental strand, 19974221 - 19974074
Alignment:
119 gtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacc-aaatggtgggactcct 216  Q
    |||| ||||||||||  |||||||||||| || |||||||||||||  |||| |||| |||| |||  ||||||| ||||||| ||||| |||||| | |    
19974221 gtcacgtgactgaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccat 19974122  T
217 tcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| || ||   |||| ||||||| |||||||| ||| ||||||||    
19974121 tcccggactctatgtatgcgggagctttagtgcacggggctgcccttt 19974074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 96 - 171
Target Start/End: Complemental strand, 25554891 - 25554817
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta 171  Q
    ||||||||| ||||||||||||||||| |||||| ||| | |||| ||| || ||||||||||| |||||||||||    
25554891 ttggcgcaa-tggtaaagttgttgtcacgtgactaaaaggccacgtgtttaagtcctggaaacaacctcttgtgta 25554817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 172
Target Start/End: Original strand, 21723658 - 21723727
Alignment:
102 caactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa 172  Q
    ||||||||||||||||||||||||||||| |  || ||  |||| | ||||||||||||||||||||||||    
21723658 caactggtaaagttgttgtcatgtgactggatggttacaagttc-agtcctggaaacagcctcttgtgtaa 21723727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 171 - 264
Target Start/End: Original strand, 46859131 - 46859225
Alignment:
171 aaaacagggtaagactgcgtaccatacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||||||||| ||||||| |||||||||||||| ||  |   || ||| |||||||||| | |||||||||||| | ||||||    
46859131 aaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgggcttcccttt 46859225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 19386628 - 19386576
Alignment:
212 ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||| |||||||||||| ||||||||||||| ||| |||||| ||||    
19386628 ctccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctcttt 19386576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 44745901 - 44745857
Alignment:
148 atcctggaaacagcctcttgtgtaaaacagggtaagactgcgtac 192  Q
    ||||||||||||||||||||||||||||| |||||  ||||||||    
44745901 atcctggaaacagcctcttgtgtaaaacaaggtaaagctgcgtac 44745857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 151
Target Start/End: Complemental strand, 28894689 - 28894646
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcc 151  Q
    |||||||||||||||||||||||||| |||||  ||||||||||    
28894689 gtaaagttgttgtcatgtgactgaaaagtcacctgttcaaatcc 28894646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 101 - 192
Target Start/End: Complemental strand, 14988084 - 14987991
Alignment:
101 gcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtac 192  Q
    ||||||||||||||||||||||| |||||  || |||||  |||||| ||||| ||||||  |||| ||||||  ||||| |||| ||||||||    
14988084 gcaactggtaaagttgttgtcatatgactagaaagtcacaagttcaagtcctgaaaacagtatcttatgtaaaatacaggataaggctgcgtac 14987991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 118 - 160
Target Start/End: Original strand, 43768168 - 43768210
Alignment:
118 tgtcatgtgactgaaatgtcacgggttcaaatcctggaaacag 160  Q
    |||||||| ||||||| ||||||||||||| ||||||||||||    
43768168 tgtcatgtcactgaaaggtcacgggttcaagtcctggaaacag 43768210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 4249520 - 4249455
Alignment:
187 gcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||| ||||||||||||||||||  |||||||||||| ||  |||| ||||||| || ||||||    
4249520 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 4249844 - 4249779
Alignment:
187 gcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||| ||||||||||||||||||  |||||||||||| ||  |||| ||||||| || ||||||    
4249844 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 4250168 - 4250103
Alignment:
187 gcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||| ||||||||||||||||||  |||||||||||| ||  |||| ||||||| || ||||||    
4250168 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4250103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 227 - 264
Target Start/End: Complemental strand, 21773676 - 21773639
Alignment:
227 tgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||| | |||||||||||||||||||    
21773676 tgcatatgtgggagctttggtgcaccgggttgcccttt 21773639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 262
Target Start/End: Original strand, 42432226 - 42432267
Alignment:
221 gaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||||||||||||||  |||||||||||||||||| |||||||    
42432226 gaaccctgcatatgctggagctctagtgcaccggattgccct 42432267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 21723728 - 21723784
Alignment:
152 tggaaacagcctcttgtgtaaaac-agggtaagactgcgtaccatacaccaaatggt 207  Q
    ||||||||||||||||| |||||  |||||||| ||| |||| ||||||||||||||    
21723728 tggaaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggt 21723784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 112 - 251
Target Start/End: Complemental strand, 49722726 - 49722586
Alignment:
112 agttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa-aacagggtaagactgcgtaccatacaccaaatggtggg 210  Q
    ||||||||||| |||| ||||| |||||||||| || || || ||||| ||||||||  || || ||||||||| ||||||| ||| |   | ||||||     
49722726 agttgttgtcacgtgaatgaaaggtcacgggtttaagtcatgtaaacaacctcttgtaaaataatagggtaagattgcgtacaatatattgattggtgga 49722627  T
211 actccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    || ||||||| |||| ||| ||||||| |||| || |||||    
49722626 accccttcccaaaccttgcgtatgtggcagctttaatgcac 49722586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 138; Significance: 6e-72; HSPs: 61)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 12670423 - 12670250
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
12670423 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 12670324  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||    
12670323 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttacccttt 12670250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 30454270 - 30454097
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||    
30454270 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaggtaaggctgcgt 30454171  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
30454170 acgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30454097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 96 - 265
Target Start/End: Original strand, 17823541 - 17823712
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    ||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||  |||| ||||||||||||      
17823541 ttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaa 17823640  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||||||||||||| || |||||||||||||||||||||  |||||| ||||||||||||||||||||||    
17823641 atacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttta 17823712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 98 - 265
Target Start/End: Original strand, 13160669 - 13160837
Alignment:
98 ggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccata 196  Q
    ||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||||||| ||||||||||||| |||||||| |||    
13160669 ggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaata 13160768  T
197 caccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||||||||||||| |||||||| ||||||| |||| |||||||  ||||| |||||||||||||||    
13160769 caccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttta 13160837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 28817801 - 28817626
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| |||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||    
28817801 taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 28817702  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||| ||||||||||| |||||||| ||||||| |||| ||||||| ||||||| |||||||||||||    
28817701 gtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttt 28817626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 36720756 - 36720931
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||| |||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||    
36720756 taaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 36720855  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| |||| || |||| ||||||||| |||||||||||    
36720856 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgcccttt 36720931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 35261639 - 35261814
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || |||||||||||||  ||||||||||| |||||||||  |||||||||||||  |||    
35261639 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgc 35261738  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||| | ||||||| |||| ||||||| |||||||||||||||||||||    
35261739 gtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 35261814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 39461171 - 39460994
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||  ||||||| ||||| ||||    
39461171 taaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgc 39461072  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||| ||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
39461071 gtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 39460994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 90 - 241
Target Start/End: Complemental strand, 20869672 - 20869523
Alignment:
90 ataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |    
20869672 ataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgtg 20869573  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagc 241  Q
    ||| |||||||||  |||| ||| |||||||| |||||||||||| ||||||    
20869572 tacaatacaccaa--ggtgagaccccttcccggaccctgcatatgcgggagc 20869523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 7136704 - 7136527
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || |||| |||||||| ||||||||||| ||||||||||||||  ||||||||| ||||    
7136704 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgc 7136605  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||| ||||||    
7136604 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttacccttt 7136527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 2626479 - 2626657
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-----aaaacagggtaagac 185  Q
    |||| ||||||||| ||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||     |||||||||||||||    
2626479 taaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagac 2626578  T
186 tgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| |||||||||||| |||||| |||||||  |||||||||||| |||||||  |||||||| | |||||||||    
2626579 tgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt 2626657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 91 - 263
Target Start/End: Original strand, 45071225 - 45071398
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcg 189  Q
    |||| ||||||  |||||||||||||||||||||||| || || ||||||||||||| | |||||||||||||||||||||||| ||||||||| |||||    
45071225 taaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 45071324  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||| ||||||||||||||||||| |||||||| ||| ||| |||| |||||||  |||||||||||||||||||    
45071325 tacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 44530109 - 44530284
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| ||||||||||||||||||||| ||||||||||||  || ||||||||||||| || |||||||| ||||||||||||||  ||||||||| ||||    
44530109 taaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgc 44530208  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||| | ||||||| |||| ||||||| ||||||||||||||| |||||    
44530209 gtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgaccttt 44530284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 6760787 - 6760959
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||||||||||||||||||||| |||||  || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| || |||||     
6760787 ttggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtaca 6760886  T
194 atacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||  ||||||||||| ||||| || |||| ||||||| ||||||| |||||||||||||||||||||    
6760887 atacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 6760959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 29521860 - 29521685
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||| ||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||||| |  ||||||||||||| ||||    
29521860 taaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgc 29521761  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||  || ||||  ||||||| |||| ||||||| |||||||||||||||| ||||    
29521760 gtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctcttt 29521685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 100 - 264
Target Start/End: Original strand, 12625858 - 12626025
Alignment:
100 cgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccata 196  Q
    |||||||||||||||||||||| |||||||   | |||||||| |||| ||||||||||| ||||||||||||||   |||||||||||||| ||| |||    
12625858 cgcaactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaata 12625957  T
197 caccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||| || ||||| ||||||| |||| ||||||| |||||||||||||||||||||    
12625958 caccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 12626025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 96 - 260
Target Start/End: Complemental strand, 18164929 - 18164764
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtacca 194  Q
    |||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||  ||||||| |    
18164929 ttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaa 18164830  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||| | || |||   |||||| ||||||| |||| ||||||| |||||||||||||||||    
18164829 tacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 18164764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 25250482 - 25250659
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||| ||||||||||||||||||||||||||||| || |||||  |||||| ||||||||||||||| ||||||  |||| |||||| | ||||    
25250482 taaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgc 25250581  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| ||||||||||||| ||||||| ||||| | |||||||||||||||||||||    
25250582 gtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttt 25250659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 97 - 264
Target Start/End: Complemental strand, 8897933 - 8897764
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtacca 194  Q
    |||| ||||||||||||||||||||||||||| | || |||||||||| || ||||||||||| || ||||||||||| |  ||||||| || ||||| |    
8897933 tggcacaactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaa 8897834  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||||| |||||||| |||||||||||| ||||||| || |||||| |||||||||||    
8897833 tacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgcccttt 8897764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 91 - 258
Target Start/End: Complemental strand, 20284248 - 20284075
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt----aaaacagggtaagact 186  Q
    |||| ||| |||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |    |||| |||||||| ||    
20284248 taaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggct 20284149  T
187 gcgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttg 258  Q
    |||||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||| | |||||||||||||||    
20284148 gcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 20284075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 91 - 258
Target Start/End: Complemental strand, 21070877 - 21070703
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-----aaaacagggtaagac 185  Q
    |||| ||| |||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |     |||| |||||||| |    
21070877 taaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggc 21070778  T
186 tgcgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttg 258  Q
    ||||||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||| | |||||||||||||||    
21070777 tgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 21070703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 108 - 242
Target Start/End: Complemental strand, 24365218 - 24365081
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaat 204  Q
    |||||||||||||||||||||| |||||||||||||||||  ||| |||||||||||||||||||||   ||||||||| ||||| || |||||||||||    
24365218 gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaat 24365119  T
205 ggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||| |||||||| ||||||| ||||||||||||    
24365118 ggtgggaccccttcccggaccctgcgtatgtgggagct 24365081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 26954092 - 26954270
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| |||||| || |||||||||||||||||||||| |  || ||||||||||||| ||||||||||||||||||||||   ||||||||||||| |||    
26954092 taactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctg 26954191  T
188 cgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| ||||||||  ||||||||||| |||||||  |||  ||||||| ||||||| |||||||| ||||||||||||    
26954192 cgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgcccttt 26954270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 28407381 - 28407538
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtacca 194  Q
    ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||| |||||||||||||               
28407381 ttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag----------- 28407469  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
      |||||||||||||||| |||||||| ||||| | |||| ||||||| || ||||||||||||||||||    
28407470 -gcaccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt 28407538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 113 - 264
Target Start/End: Original strand, 31457155 - 31457307
Alignment:
113 gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaac-agggtaagactgcgtaccatacaccaaatggtggga 211  Q
    |||||||||||||| |||||| ||||||||||||| ||||| ||||| ||||||||||||||  |||  ||| |||||||| ||||| |||||||| |||    
31457155 gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtagga 31457254  T
212 ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | ||||||| |||||||| |||| ||||||||||||||||||| |||||||||    
31457255 ccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcccttt 31457307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 91 - 234
Target Start/End: Original strand, 11748259 - 11748406
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| |||| ||||||||| || |||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||  ||||||||||| ||    
11748259 taactttggtgcaactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaagacagc 11748358  T
189 gtac--catacaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
    ||||   |||||  ||||||| |||| |||||||||| ||||||||||    
11748359 gtacaatatacaaaaaatggtaggaccccttcccgaatcctgcatatg 11748406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 152 - 264
Target Start/End: Original strand, 19729363 - 19729475
Alignment:
152 tggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    ||||||||| ||||| |||||||||||||||| ||| |||| ||||||||||||||||||| |||||||| |||||||||||  ||||||||||||||||    
19729363 tggaaacagtctcttatgtaaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcac 19729462  T
252 cgggttgcccttt 264  Q
     || |||||||||    
19729463 tggattgcccttt 19729475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 96 - 263
Target Start/End: Complemental strand, 42083868 - 42083699
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtacc 193  Q
    |||||||||| |||||| ||||||||| |||||||||| ||||||||||||| ||||||||||||||| |||||||||| |  ||| ||| ||||||||     
42083868 ttggcgcaac-ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtaca 42083770  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
     || ||| |||||||||||| |||||||||||||||  || ||||||||| |||||||  ||| |||||||    
42083769 gtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgccctt 42083699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 96 - 251
Target Start/End: Complemental strand, 44781675 - 44781517
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| ||||||||||  |||||||||||| ||||||||||| |||||||||||||  |||||||||| ||| ||||     
44781675 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtaca 44781577  T
194 atacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    |||||||  ||||| |||||| || ||||  ||||||| |||| ||||||| ||||||||    
44781576 atacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 132 - 264
Target Start/End: Complemental strand, 5135423 - 5135290
Alignment:
132 aatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgc 229  Q
    |||| ||||||||||| |||||||||||||||||||||||||| ||  |||||| ||| |||| ||||||||||||||||||| |||||||| |||||||    
5135423 aatggcacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgc 5135324  T
230 atatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||||  |||||| | |||||||||| ||||||||    
5135323 gtatgcaggagct-ttgtgcaccgggctgcccttt 5135290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 140 - 259
Target Start/End: Original strand, 5689640 - 5689761
Alignment:
140 gggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgg 237  Q
    |||||||| || || ||| ||||||||||||||||  ||||||||| |||||||| |||||||||||||||| || |||||||||||| ||| |||||||    
5689640 gggttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgg 5689739  T
238 gagctctagtgcaccgggttgc 259  Q
    ||||| ||||||||||| ||||    
5689740 gagctttagtgcaccggtttgc 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 96 - 255
Target Start/End: Complemental strand, 8484107 - 8483947
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||  |||| || |||||| |||||||| |||||||| ||||||||||| ||||||||||  ||||||||| ||| ||||||||     
8484107 ttggcgcaac-ggtaaagcggttgccacgtgacttaaatgtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtaca 8484009  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    ||||||||| ||||||||| || ||||  ||||||| |||| ||||||| ||| ||||||||    
8484008 atacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg 8483947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 149 - 264
Target Start/End: Original strand, 20869941 - 20870060
Alignment:
149 tcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctct 244  Q
    |||||||||||| |||||||||||||  ||||||||| |||||||| |||||||||  |||||||||| |||||| | |||| ||||||| ||||||| |    
20869941 tcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagcttt 20870040  T
245 agtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||||    
20870041 agtgcaccgggttgcccttt 20870060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 91 - 242
Target Start/End: Original strand, 24245411 - 24245562
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | ||||| |||  |||||||||||||| |||    
24245411 taaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt--aacagggtaagactacgt 24245507  T
191 accatacacc---aaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    || || ||||   |||| ||||||| |||||| | ||||||| |||| |||||||    
24245508 acaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagct 24245562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 107 - 252
Target Start/End: Original strand, 22598133 - 22598279
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||  ||||||||| ||||||||||||||||||||||||| ||||||||||  ||||||||||||| ||  |||| ||||||||| |    
22598133 ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaatt 22598232  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||| ||| | |||||| ||| ||| |||| |||| || |||||||||    
22598233 ggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc 22598279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 149 - 262
Target Start/End: Original strand, 29877112 - 29877227
Alignment:
149 tcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctag 246  Q
    ||||||||||||||| ||||||||||  ||||||||| |||||||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||  |||    
29877112 tcctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttag 29877211  T
247 tgcaccgggttgccct 262  Q
    |||||| || ||||||    
29877212 tgcaccaggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 266
Target Start/End: Original strand, 16225045 - 16225158
Alignment:
157 acagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||||||| |||||||  |||||||||||||||||| |||||||||  |||||||||  |||||||| |||| ||||||| ||||||| |||||||||    
16225045 acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc 16225144  T
253 gggttgccctttat 266  Q
    |||||| |||||||    
16225145 gggttgtcctttat 16225158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 194 - 264
Target Start/End: Original strand, 26102582 - 26102652
Alignment:
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| |||||||| ||||||| |||| |||||||||||||||||||||||||||||    
26102582 atacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttt 26102652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 107 - 228
Target Start/End: Complemental strand, 11001109 - 11000985
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||| ||||| ||| ||||||||||| ||| ||||| |||  |||||   |||||| | |||| ||| |||| ||||||||||    
11001109 ggtaaagttgttgtcatgtgattgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaaa 11001010  T
204 tggtgggactccttcccgaaccctg 228  Q
    ||||||||| ||| |||||||||||    
11001009 tggtgggacccctacccgaaccctg 11000985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 96 - 230
Target Start/End: Complemental strand, 14018138 - 14018002
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||| |||||||||| |||| ||||| |||| |||||||| || ||||||||| |||||||||  |||||||||| |||||||||||     
14018138 ttggcgcaac-ggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtaca 14018040  T
194 atacaccaaa-tggtgggactccttcccgaaccctgca 230  Q
    |||||| ||| |||||||||  ||||| | ||||||||    
14018039 atacactaaattggtgggaccacttcctggaccctgca 14018002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 23000365 - 23000262
Alignment:
117 ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactcc 215  Q
    ||||||||||||||||| |||||||||  || |||||||||||||||||||||| |||||| ||||||  | | ||| ||||||||||||||||||| ||    
23000365 ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggacccc 23000268  T
216 ttcccg 221  Q
    ||||||    
23000267 ttcccg 23000262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 110 - 212
Target Start/End: Original strand, 35105902 - 35106007
Alignment:
110 aaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacca-aatgg 206  Q
    ||||||||||||| ||| |||||| ||||||||||||| ||||||||||| |||||||||||||  | || ||||| |||||||| |||||||| |||||    
35105902 aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatgg 35106001  T
207 tgggac 212  Q
    ||||||    
35106002 tgggac 35106007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 153 - 264
Target Start/End: Original strand, 10857850 - 10857964
Alignment:
153 ggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgc 249  Q
    |||||| |||||||||||||||   ||||||||| ||||| || ||||||||| |||||||||  ||||| | ||| ||| |||| ||||||| ||||||    
10857850 ggaaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgc 10857949  T
250 accgggttgcccttt 264  Q
    |||||||||||||||    
10857950 accgggttgcccttt 10857964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 130 - 254
Target Start/End: Original strand, 389642 - 389770
Alignment:
130 gaaatgtcacgggttcaaatcctggaaacagcctcttgtgt----aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaacc 225  Q
    |||| ||||||||||||| ||||||||||| ||||||||||    |||||||||||||  ||||||| |||||||||||| |||||  |||| ||  |||    
389642 gaaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgacc 389741  T
226 ctgcatatgtgggagctctagtgcaccgg 254  Q
    |||| |||| | ||||| |||||||||||    
389742 ctgcgtatgcgagagctttagtgcaccgg 389770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 265
Target Start/End: Complemental strand, 23286432 - 23286336
Alignment:
157 acagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggt 256  Q
    ||||||||||||||||||||||||||  |||||||| |||||||||||||||||            |||||||||||| ||||||||||||||||||||     
23286432 acagcctcttgtgtaaaacagggtaaagctgcgtacaatacaccaaatggtggg------------accctgcatatgcgggagctctagtgcaccgggc 23286345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 30962942 - 30962865
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| || |||||||||||||||||| ||||| ||||||  ||||| ||||||||||||||||||||||||||    
30962942 ttggcgcaac-ggaaaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaa 30962865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 142 - 261
Target Start/End: Complemental strand, 17251001 - 17250879
Alignment:
142 gttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgg 237  Q
    |||||| |||||||| |||||||||||||||||  |||| |||| | |||||| |||||||||  |||||||||| | |||||||||||||| ||||  |    
17251001 gttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaag 17250902  T
238 gagctctagtgcaccgggttgccc 261  Q
    ||||| ||||||| ||||||||||    
17250901 gagctttagtgca-cgggttgccc 17250879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 204 - 263
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||||||||| |||||||||||||||| |||| ||||||| ||||||||||||||| ||||    
27507985 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt 27508044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 107 - 261
Target Start/End: Complemental strand, 44742678 - 44742521
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||||||||||||  |||| || || |||| | |||||| | |||||||||  ||| |||||||||  ||||||||| |||||||| ||||||| |||    
44742678 ggtaaagttgttgtcgcgtgattgtaaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaa 44742579  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    ||||||||| |||||  | ||||| |  ||| ||||||  |||||||||||| |||||    
44742578 tggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc 44742521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 40605080 - 40604906
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||| || |   | | |||||||| || ||||||||  || |||||||||| |  || ||||  |||    
40605080 taactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggataaggttgc 40604981  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||| ||||| | |||  ||||||  |||||| | |||| ||||||| ||||||||||  |||||||||    
40604980 gtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgcccttt 40604906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 122 - 160
Target Start/End: Original strand, 27635020 - 27635058
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacag 160  Q
    |||||||||||||||||||||||||| ||||||||||||    
27635020 atgtgactgaaatgtcacgggttcaagtcctggaaacag 27635058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 139 - 265
Target Start/End: Original strand, 33866957 - 33867088
Alignment:
139 cgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaa--tggtgggactccttcccgaaccctgcatat 233  Q
    ||||||||| ||||  ||||| | | ||||||||||   |||||||||||||| ||| |||||  |||  |||||  ||| ||||||||||||||| |||    
33866957 cgggttcaagtcctaaaaacaactttttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtat 33867056  T
234 gtgggagctctagtgcaccgggttgcccttta 265  Q
    |  | |||| ||||||||||||||||||||||    
33867057 gcagaagctttagtgcaccgggttgcccttta 33867088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 215 - 264
Target Start/End: Complemental strand, 27468141 - 27468092
Alignment:
215 cttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 27468092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 16013528 - 16013591
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| ||| |||||||  ||||||| |||| ||||||| ||||||||||||||| |||||    
16013528 aaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttt 16013591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 264
Target Start/End: Complemental strand, 35107374 - 35107311
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||||||| || |||  |||| || |||| |||||||||||||||||||||    
35107374 aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt 35107311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 43942348 - 43942417
Alignment:
155 aaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc--aaatggtgggactccttccc 220  Q
    |||||||||||| |||  ||||||||||||| |||||||| |||||||  |||||||||||| |||||||    
43942348 aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttccc 43942417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 257
Target Start/End: Original strand, 26457776 - 26457855
Alignment:
176 agggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggtt 257  Q
    |||||||| |||||||| ||||||||| ||||||||| |||  ||  ||| ||| |||| ||||||| ||||||||||||||    
26457776 agggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtt 26457855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 91 - 128
Target Start/End: Complemental strand, 23286468 - 23286431
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgac 128  Q
    |||| ||| |||||||||||||||||||||||||||||    
23286468 taaccttgtcgcaactggtaaagttgttgtcatgtgac 23286431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 227
Target Start/End: Original strand, 36918102 - 36918222
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatgg 206  Q
    |||| ||||||| |||  ||||||| |||||  |||||| | |||||||||   |||| |||||||  ||||||||| ||| |||| ||||||||||| |    
36918102 taaaattgttgttatggaactgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaatag 36918201  T
207 tgggactccttcccgaaccct 227  Q
    | ||| |||||||| ||||||    
36918202 taggattccttcccaaaccct 36918222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 175 - 250
Target Start/End: Complemental strand, 30231420 - 30231344
Alignment:
175 cagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    |||| |||| |||||||| ||| |||||| ||||||||| | | |||||||||| |||| ||||||||| |||||||    
30231420 caggataaggctgcgtacaatataccaaaatggtgggacccttacccgaaccctccatacgtgggagctttagtgca 30231344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 40607890 - 40607830
Alignment:
100 cgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacag 160  Q
    ||||| |||||||||||||||||||| |||| ||||||| | |||||| ||| | ||||||    
40607890 cgcaattggtaaagttgttgtcatgtaactggaatgtcatgagttcaagtcccgaaaacag 40607830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 138; Significance: 6e-72; HSPs: 77)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 21172182 - 21172009
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
21172182 taaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 21172083  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
21172082 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 21172009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 32758221 - 32758394
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||| ||| ||    
32758221 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgtgt 32758320  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
32758321 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 32758394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 96 - 265
Target Start/End: Complemental strand, 10693241 - 10693072
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccat 195  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| ||    
10693241 ttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaagagggtaaggctgcgtacaat 10693142  T
196 acaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||||||| |||||||| |||||||||||| |||||||||||||||| |||||||||||||    
10693141 acaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttta 10693072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 91 - 267
Target Start/End: Complemental strand, 48735296 - 48735119
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcct-ggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||| |||||||||||||||| |||||| |||||    
48735296 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacacggtaaggctgcg 48735197  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    ||| ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
48735196 tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttata 48735119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 113 - 264
Target Start/End: Complemental strand, 42391251 - 42391100
Alignment:
113 gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||    
42391251 gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggac 42391152  T
213 tccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     |||||||| |||||||||||| |||||||||||||||||||||||||||||    
42391151 cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 42391100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 91 - 265
Target Start/End: Complemental strand, 2541195 - 2541018
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactg-aaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactg 187  Q
    |||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||  ||||||||| |||    
2541195 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg 2541096  T
188 cgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||| ||||||||||||||||||| ||||||||  |||||| |||| ||||||| |||||||||||||| |||||||    
2541095 cgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttta 2541018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 19427059 - 19426890
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    ||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||  |||| |||||||||||||||||     
19427059 ttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtaca 19426960  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| ||||| || |||||||||||| | |||||  ||||||||||||||||||||    
19426959 atacaccaaatggtgggac-ccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcccttt 19426890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 91 - 260
Target Start/End: Complemental strand, 47078028 - 47077859
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||| || ||||   |||||    
47078028 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaatagagtaaagttgcgt 47077929  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    || |||||| |||||||||||| ||||||| |||||| |||||| ||||||||||||||||||| |||||    
47077928 acaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc 47077859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 98 - 263
Target Start/End: Complemental strand, 11617756 - 11617589
Alignment:
98 ggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccat 195  Q
    |||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| ||||||||||  |||||||||||||||||||||| ||    
11617756 ggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaat 11617657  T
196 acaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||||||||||||||||| |||||| | ||||||| ||||  ||| || ||||||||||||||||||||    
11617656 acaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt 11617589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 42798629 - 42798804
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| || ||||||||| |||||||||  |||||| |||||| ||||    
42798629 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgc 42798728  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| | |||||| |||||||||||| ||||||| ||||||| |||||||||||||    
42798729 gtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttt 42798804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 42805484 - 42805661
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||| |||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| |||     
42805484 taaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgt 42805583  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||||||||||    
42805584 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 42805661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 91 - 263
Target Start/End: Original strand, 42476833 - 42477005
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    ||||||||||| ||||||||||||||||||||||||||| ||| ||||||| ||||| | |||||||||| ||||||||||||||| |||||| ||||||    
42476833 taacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaacaaggtaaggctgcgt 42476932  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    || ||||||||||||||||||| ||||||    | ||||||||| ||||||||||||||||| ||||||||||    
42476933 acaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 27629599 - 27629769
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||||||||||||||||||||| |||| |||| ||||||||||||| ||||||||||||||||||||||  |||||||||||||  ||||||      
27629599 ttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaa 27629698  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| ||||||||  ||||||||||| || ||||  ||||||||||||||||||||    
27629699 atacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttt 27629769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 91 - 267
Target Start/End: Original strand, 47716419 - 47716599
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||| ||||||| |||||||||| |||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||    
47716419 taaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 47716518  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| ||||||| | ||||||||||||||||||||||    
47716519 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgccctttata 47716599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 90 - 262
Target Start/End: Complemental strand, 35334990 - 35334818
Alignment:
90 ataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    ||||| ||||||||||||||||||||||||||||||||||| || |||||| |||||| |||||||||||| ||| |||  ||||||||||||||||| |    
35334990 ataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctcgtgtaaaaaacagggtaagactgtg 35334891  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||| ||||||| ||||||||||| |||||||| ||||||| ||||  |||||| |||||||||||||| ||||    
35334890 tacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct 35334818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 94 - 264
Target Start/End: Original strand, 19265779 - 19265948
Alignment:
94 cattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtac 192  Q
    |||||||||||| |||||||||||||||| |||||||||| ||||||||||||| || |||| |||||| ||||||| |||| |||||||| ||||||||    
19265779 cattggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggtaaggctgcgtac 19265877  T
193 catacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||||||||||||||||||| |||||||| | ||| |||||||||||||| |||||||||||| ||||||||    
19265878 aatacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgcccttt 19265948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 87 - 264
Target Start/End: Original strand, 40463833 - 40464011
Alignment:
87 cttataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagac 185  Q
    |||||||| |||||||||| |||||||||||||||||||||||| || ||||||||||||| || | ||||||| ||||||||| ||||| ||||||| |    
40463833 cttataaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggtaaggc 40463932  T
186 tgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||  ||||||||||||||||||| ||||| || ||||||| |||| |||||||  ||||||||| ||||||||||    
40463933 tgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttt 40464011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 110 - 263
Target Start/End: Original strand, 11741774 - 11741927
Alignment:
110 aaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgg 209  Q
    |||||||||||||||||||||||| |||| |||||||| ||||| ||||||| ||| |||||||| |||||||| |||||||| ||||||||||||||||    
11741774 aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaatagggtaaggctgcgtacaatacaccaaatggtgg 11741873  T
210 gactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||  |||||||| |  ||||| ||| ||||||||||||||||||||||||||||    
11741874 gatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt 11741927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 43557432 - 43557610
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||| |||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||  ||||||| ||||| ||||    
43557432 taaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgc 43557531  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagc-tctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| || ||||| || |||| |||| |||||| | |||||||||||||||||||||    
43557532 gtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcccttt 43557610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 105 - 267
Target Start/End: Complemental strand, 33872070 - 33871907
Alignment:
105 ctggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||| |||||||||| |||||||| |||| |||||||| ||||||||||    
33872070 ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaa 33871971  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    ||||||||| |||||||  ||||||  |||| | ||||| ||||||||| ||||||| ||||||    
33871970 tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgccttttata 33871907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 99 - 264
Target Start/End: Complemental strand, 34626374 - 34626208
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatac 197  Q
    ||||||||||||||||||||||||||||| ||||| | ||| | ||||| |||||||||||||||| ||||||||| ||||||||| |||||| | ||||    
34626374 gcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatac 34626275  T
198 accaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||  |||||||| ||||||| |||| ||||||| |||| || |||||||||||||    
34626274 accaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcccttt 34626208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 128 - 264
Target Start/End: Complemental strand, 31591245 - 31591109
Alignment:
128 ctgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccct 227  Q
    |||||| |||||| |||||| ||||||||||| ||||||||||||||||| ||||| |||||||| |||||  |||||||||||| |||||||| ||| |    
31591245 ctgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaacagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggacctt 31591146  T
228 gcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| |||||||||||||||||||||||||||||    
31591145 gcatatgcgggagctctagtgcaccgggttgcccttt 31591109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 91 - 267
Target Start/End: Complemental strand, 22699145 - 22698964
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||| |||||||||||||||||||||||||||||||||| || | |||||||| ||||||||| || |||||||||  ||||||||||||||||||    
22699145 taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaagactgc 22699046  T
189 gtaccatacacc--aaatggtgggactc-cttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    |||| |||||||  |||||||||||| |  |||||| ||||||  |||| ||||||| |||||||||||||| |||||||||    
22699045 gtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttaccctttata 22698964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 91 - 234
Target Start/End: Original strand, 46354154 - 46354301
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||| || || ||||||||||||| ||||||||||| ||||||||||  ||||||||||||| ||||    
46354154 taaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgc 46354253  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatg 234  Q
    |||| ||||||||  ||||||||||| |||||||| |||| |||||||    
46354254 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatg 46354301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 91 - 254
Target Start/End: Complemental strand, 2663106 - 2662946
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||||||| ||||||||||||| ||||||||| |  ||||  ||||||| |||||||||||||||||||||||||| |||||||| ||||||    
2663106 taaccttggcgcaactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctgcgt 2663009  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    || ||||||||||||||||||| ||||  |  |||||||||||| ||||||||||| |||||||    
2663008 acaatacaccaaatggtgggac-ccttttcagaccctgcatatgcgggagctctagcgcaccgg 2662946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 14732997 - 14732821
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcct--cttgtgtaaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||  | |||  ||||||||||||| ||||    
14732997 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggctgc 14732898  T
189 gtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || | |||||||  ||||||||  ||||||||||||||||||  |||| ||||||| ||||||||||| ||| |||||    
14732897 gt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtccttt 14732821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 96 - 265
Target Start/End: Complemental strand, 23419843 - 23419673
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||| |||||||||||| ||| ||||| ||||||| | ||||||||||||||||||||  ||||||||||||||||||||||     
23419843 ttggcgcaac-ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtaca 23419745  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||||||||| ||||||   ||| ||| | || ||| ||| ||||||| |||| |||||||||    
23419744 atacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttta 23419673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 96 - 242
Target Start/End: Original strand, 13805068 - 13805214
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca-gggtaagactgcgtacca 194  Q
    ||||||||| |||||||||||||||||||||||||||| || |||||||||| ||||||||| ||||||| |||||||||| ||||||| ||| |||| |    
13805068 ttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaa 13805166  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||||||||||||||||||  ||||| | ||||||| |||| |||||||    
13805167 tacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagct 13805214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 107 - 227
Target Start/End: Complemental strand, 14099165 - 14099043
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||||||||||||| |||| ||||| || ||||||||| ||||| ||||||||||  |||| ||||||||||||| |||||||||||    
14099165 ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat 14099066  T
205 ggtgggactccttcccgaaccct 227  Q
    |||||||| ||||||||||||||    
14099065 ggtgggaccccttcccgaaccct 14099043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 107 - 227
Target Start/End: Complemental strand, 14409182 - 14409060
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||||||||||||| |||| ||||| || ||||||||| ||||| ||||||||||  |||| ||||||||||||| |||||||||||    
14409182 ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat 14409083  T
205 ggtgggactccttcccgaaccct 227  Q
    |||||||| ||||||||||||||    
14409082 ggtgggaccccttcccgaaccct 14409060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 114 - 264
Target Start/End: Complemental strand, 32233286 - 32233135
Alignment:
114 ttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    |||||||||  ||||||||| |||| |||||||| ||||||||||| |||||||||||||| ||||||||| | |||||   |||||||||||||||||     
32233286 ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggat 32233187  T
213 tccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| ||||||||||||| |||||||  ||||||||||| ||||||||    
32233186 tccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgcccttt 32233135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 96 - 255
Target Start/End: Complemental strand, 28362314 - 28362155
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||||||| |||||| ||||| ||||||| |||| ||||| |||||||||||  |||||  |||||| ||||||||     
28362314 ttggcgcaac-ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtaca 28362216  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    ||||||||||||||||||| |||||||  ||| |||||||||||||||| | ||||||||||    
28362215 atacaccaaatggtgggaccccttcccagaccttgcatatgtgggagct-ttgtgcaccggg 28362155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 135 - 264
Target Start/End: Original strand, 7879642 - 7879773
Alignment:
135 gtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcata 232  Q
    ||||||||||||| |||||||||||  |||||||||||||  || |||||| |||||||| ||||||||||||||||||| |||||||| ||||||| ||    
7879642 gtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgta 7879741  T
233 tgtgggagctctagtgcaccgggttgcccttt 264  Q
    || |||||||  ||||||||||||||||||||    
7879742 tgcgggagcttcagtgcaccgggttgcccttt 7879773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 117 - 263
Target Start/End: Original strand, 18747472 - 18747621
Alignment:
117 ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaatggtgggact 213  Q
    |||||| |||||||||| |||||||| |||| || |||||||||||| ||||||||||   ||||||||| |||||||  ||||||||| |||||||||     
18747472 ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggacc 18747571  T
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    |||||| ||||||||| |||| ||||||| |||||||||||| |||||||    
18747572 ccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 96 - 240
Target Start/End: Complemental strand, 48123653 - 48123508
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa--aacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||| ||||||| |||||| |||| |||||||| ||||||||||||||||||||||||  |||||||||| ||||| |||     
48123653 ttggcgcaac-ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcataca 48123555  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggag 240  Q
    ||||||||||||||||||| |||| | | ||| |||||||| |||||    
48123554 atacaccaaatggtgggacccctttctggaccatgcatatgcgggag 48123508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 107 - 263
Target Start/End: Original strand, 29907393 - 29907552
Alignment:
107 ggtaaagttgttgt--catgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-a 201  Q
    ||||||||||||||  ||||||||||||| ||||||||||||| |||| |||||||||||||||||  |||| || ||||| |||||| | ||||||| |    
29907393 ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa 29907492  T
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||||||||||| || ||||| ||||||  |||| ||||||| ||||||||||||||||||||    
29907493 aatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt 29907552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 91 - 203
Target Start/End: Complemental strand, 5180332 - 5180218
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||| |||||||||||||||||||||||||||||||||| |||| |||||||| | ||||||||||||||||||||  |||||||||||||||||     
5180332 taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaagactgt 5180233  T
189 gtaccatacaccaaa 203  Q
    |||| | ||||||||    
5180232 gtacaacacaccaaa 5180218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 130 - 262
Target Start/End: Complemental strand, 18512588 - 18512455
Alignment:
130 gaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaac-agggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctg 228  Q
    |||| ||||||||||||| ||||||||||| | ||||||||||||  |||||||| |||||||| ||||||| ||||||||||| |||||||| ||||||    
18512588 gaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctg 18512489  T
229 catatgtgggagctctagtgcaccgggttgccct 262  Q
    | |||| ||||||| | |||||| ||||||||||    
18512488 cgtatgcgggagctttggtgcactgggttgccct 18512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 91 - 183
Target Start/End: Complemental strand, 42496010 - 42495917
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaag 183  Q
    |||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||| | |||||||||||||    
42496010 taaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggtaag 42495917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 107 - 242
Target Start/End: Original strand, 19266426 - 19266563
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||||||||||||| |||  |||||||| ||||| ||| |||| |||| ||||||  ||||||||| |||||||| |||||||||||    
19266426 ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaat 19266525  T
205 ggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
     ||||||  |||||||| ||||||| |||| |||||||    
19266526 tgtgggatcccttcccggaccctgcgtatgcgggagct 19266563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 97 - 234
Target Start/End: Complemental strand, 28078300 - 28078162
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgt-gtaaaacagggtaagactgcgtaccat 195  Q
    |||||||||| || |||||||||||||||||||| || ||||||||||||| |||| ||||||| ||| |||   |||||||||||||  ||| | | ||    
28078300 tggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggtaaggttgcatgcaat 28078201  T
196 acaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
    ||||||||||||||||| |||||||||| ||||||||||    
28078200 acaccaaatggtgggaccccttcccgaatcctgcatatg 28078162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 91 - 183
Target Start/End: Original strand, 18326994 - 18327087
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaag 183  Q
    |||| ||||||||||||||||||||||||||||||||||  || ||||||||||||| ||| |||||||||||||||||| |||||||||||||    
18326994 taaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggtaag 18327087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 122 - 264
Target Start/End: Complemental strand, 38262340 - 38262196
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaatggtgggactccttcc 219  Q
    ||||||||| || ||||||||||||| |||||||||||| ||||||||||||| |   |||||   ||| ||| |||||||||||| |||||| ||||||    
38262340 atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcc 38262241  T
220 cgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| |||| |||| ||||||| ||||||||||| |||||||||    
38262240 cgaacactgcgtatgcgggagctttagtgcaccggattgcccttt 38262196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
135 gtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcat 231  Q
    ||||| ||||||| || ||||||| |||||||||||||||  ||| | |||||||||||| |||||||||| |||| |||| ||||||||||||||||||    
21566439 gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat 21566538  T
232 atgtgggagctctagtgcaccggg 255  Q
    ||| ||||||| ||||||||||||    
21566539 atgcgggagctttagtgcaccggg 21566562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 91 - 220
Target Start/End: Complemental strand, 8149121 - 8148989
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| ||||| |||||||||| |||||||||||||||||| || |||||| |||||| ||||| ||||  ||||||||||   |||| ||||||||  ||    
8149121 taaccttggcacaactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaaggttg 8149022  T
188 cgtaccatacaccaaatggtgggactccttccc 220  Q
    ||||| ||||||||||||||||||| |||||||    
8149021 cgtacaatacaccaaatggtgggaccccttccc 8148989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 97 - 252
Target Start/End: Original strand, 39123857 - 39124018
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggt----aagactgcgta 191  Q
    |||||||| |||||||||||||||||||||||||||| | ||||||||||| |||| ||||| | ||||||||| ||||||||||    ||| |||||||    
39123857 tggcgcaa-tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgta 39123955  T
192 ccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
      |||||||  |||||||||||| |||||||| ||||||| |||| ||||||| | |||||||    
39123956 aaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc 39124018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 7644931 - 7645047
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aa 202  Q
    ||||||| ||||||| | |||||||||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||||  |||||| ||||||| ||    
7644931 tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaa 7645030  T
203 atggtgggactccttcc 219  Q
    || ||||||| ||||||    
7645031 attgtgggaccccttcc 7645047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 150 - 256
Target Start/End: Original strand, 38604546 - 38604654
Alignment:
150 cctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctct-agt 247  Q
    ||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||| ||| |||| ||| ||||||| |||| ||||||| | |||    
38604546 cctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagt 38604645  T
248 gcaccgggt 256  Q
    |||||||||    
38604646 gcaccgggt 38604654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 91 - 174
Target Start/End: Complemental strand, 1424085 - 1424002
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| ||||||||||||||||||||||||| ||||||||| || ||||||| |||||||||||||||||| || ||||||||||    
1424085 taactttggcgcaactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaa 1424002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7794673 - 7794598
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||||||||||||||| ||||||||| || ||||||||||||| |||||||||||||||||| |||||||    
7794673 gcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaa 7794598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 108 - 209
Target Start/End: Original strand, 6736867 - 6736969
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatgg 206  Q
    ||||||||||||||||| |||||||| ||||||||||||| ||||  ||||| |||||||| | |||||| ||||||||||| ||| |||||||||||||    
6736867 gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatgg 6736966  T
207 tgg 209  Q
    |||    
6736967 tgg 6736969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 91 - 173
Target Start/End: Original strand, 7193045 - 7193127
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa 173  Q
    |||| |||||| |||| |||||||||||||||||||||||||| ||||||||||||| |||| |||||| |||||||||||||    
7193045 taaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa 7193127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 203
Target Start/End: Original strand, 12473269 - 12473378
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||||||  |||||| |||| |||||||| ||||| ||||| ||||||||||  |||||||||||||  |||||||     
12473269 ttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtaca 12473368  T
194 atacaccaaa 203  Q
    ||||||||||    
12473369 atacaccaaa 12473378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 107 - 263
Target Start/End: Original strand, 16341254 - 16341413
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||||||||| ||||||   ||||| ||||||||||||| | || |||||||||||||||||  ||||||||||||| || ||||| ||||||| |||    
16341254 ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaa 16341353  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||||||| |  ||||||| |||   |||||| ||||||| | |||||||||| |||||||    
16341354 tggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgccctt 16341413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 156 - 264
Target Start/End: Complemental strand, 35787378 - 35787269
Alignment:
156 aacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    ||||||||||||||||||| || ||||||  ||||||| ||||||||||||| ||||| |||||||| ||| ||| |||| |||||||  | ||||||||    
35787378 aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg 35787279  T
255 gttgcccttt 264  Q
    ||||||||||    
35787278 gttgcccttt 35787269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 149 - 265
Target Start/End: Original strand, 23231575 - 23231693
Alignment:
149 tcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctag 246  Q
    ||||||||| |||||||||||||||| |   |||||| |||||||  ||||||| |||| |||||| |||||||||||||||| |||| || |||| |||    
23231575 tcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttag 23231674  T
247 tgcaccgggttgcccttta 265  Q
    ||||||| ||| |||||||    
23231675 tgcaccgagtttcccttta 23231693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 25198682 - 25198861
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaa---tcctggaaacagcctcttgtgt---aaaacagggtaaga 184  Q
    |||| |||||| ||||||||||||||||||||| |||||||||  ||| ||| |||||   || ||||||||| || ||||||   |||||| |||||||    
25198682 taaccttggcgtaactggtaaagttgttgtcatatgactgaaagatcatgggatcaaaaagtcttggaaacagtcttttgtgtaaaaaaacaaggtaaga 25198781  T
185 ctgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | |||||  || ||| ||||||| |||  |||||||  ||||| | |||||| ||||| |||||||||||||||| ||||    
25198782 ccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcacttt 25198861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 27889395 - 27889316
Alignment:
185 ctgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| | || ||||||||||||||||    
27889395 ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttt 27889316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 96 - 263
Target Start/End: Complemental strand, 3469348 - 3469176
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt----aaaacagggtaagactgcgta 191  Q
    |||||||||| ||||||||||||||||||||||||||| ||||| |  |||| |||| ||||||  |||||||||    ||||||||||| |  ||||||    
3469348 ttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcgta 3469250  T
192 ccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    | |||||||  |||||| ||||| ||||||   ||||||  |||| ||||||| |||||| | |||||||||||    
3469249 caatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt 3469176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 44123780 - 44123713
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| ||||||||||||||||  | |||||||||| | ||||||||||||||||||||||||    
44123780 ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgtaaaa 44123713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 143 - 234
Target Start/End: Original strand, 1408469 - 1408562
Alignment:
143 ttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
    ||||| ||||||||| ||||||||||||||||  || |||||| ||| |||| ||||| ||||||||||||| |||||||| ||||||| ||||    
1408469 ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatg 1408562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 21447550 - 21447633
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||||||||||| |||| |||||||||||| | || || ||||||| ||||| || || ||||||||||||||||||||    
21447550 taaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaa 21447633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 35203437 - 35203554
Alignment:
129 tgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc--aaatggtgggactccttcccgaac 224  Q
    ||||| ||||||||||||| |||||||||||  |||||||||  |||||||| ||||||||||||| ||| |||  |||||||||||  |||||| ||||    
35203437 tgaaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaac 35203536  T
225 cctgcatatgtgggagct 242  Q
     || | |||| |||||||    
35203537 tctacgtatgcgggagct 35203554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 23066003 - 23065925
Alignment:
186 tgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| |||||||| ||| |||||  |||| ||||| |||||||||||||||||| | ||||||||| |||||||||    
23066003 tgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcccttt 23065925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 42102044 - 42101919
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctctt--gtgtaaaacagggtaagactgcgtaccatacaccaaa- 203  Q
    |||||||||||||||| ||||||| || ||||   |||||| ||||||||||||||||||  ||  |||||||||||| |||||||||  ||| | |||     
42102044 ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaag 42101945  T
204 tggtgggactccttcccgaaccctgc 229  Q
    ||||||||| | |||||| |||||||    
42101944 tggtgggaccctttcccggaccctgc 42101919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 237
Target Start/End: Complemental strand, 15108528 - 15108424
Alignment:
134 tgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcata 232  Q
    ||||||| |||||| ||||||||||||  |||||||| |||||| |||||| ||| |||| ||||| ||||| ||||||  ||||||| |||||||  ||    
15108528 tgtcacgagttcaagtcctggaaacagtttcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttcccaaaccctgtgta 15108429  T
233 tgtgg 237  Q
    |||||    
15108428 tgtgg 15108424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 106 - 224
Target Start/End: Original strand, 22065563 - 22065682
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||| |||| ||||| |||| | |||||| |  |||||||| |||||||||| |||| |||||||  |||| ||| ||| | |||||    
22065563 tggtaaagttgttgtcacgtgattgaaaagtcatgagttcaagttttggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaat 22065662  T
205 ggtgggactccttcccgaac 224  Q
     ||| ||| |||||||||||    
22065663 agtgagaccccttcccgaac 22065682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 96 - 139
Target Start/End: Complemental strand, 29140530 - 29140487
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcac 139  Q
    |||||||||||||||||||||||||||||| ||||||| |||||    
29140530 ttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcac 29140487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 172 - 239
Target Start/End: Original strand, 33500556 - 33500625
Alignment:
172 aaacagggtaagactgcgtaccatacac--caaatggtgggactccttcccgaaccctgcatatgtggga 239  Q
    ||||||||||||||||||||| ||||||   |||||||||||| |||||||| ||||||| |||| ||||    
33500556 aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga 33500625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 172 - 264
Target Start/End: Complemental strand, 39093532 - 39093439
Alignment:
172 aaacagggtaagactgcgtaccatacacca-aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||| |||| |||||||| ||| ||||||  |||||||| | | ||||||||  | |||| |||||||||||| ||||||||    
39093532 aaacagggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttt 39093439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 204 - 264
Target Start/End: Complemental strand, 45018983 - 45018923
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| || |||||||| ||||||| |||| ||||||| ||||||||| |||||||||||    
45018983 tggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt 45018923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 5814436 - 5814514
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||  |||||||||||||| |||||| || || ||||||||||||| |  |||||| | |||||| |||||||    
5814436 ttggcgcaatcggtaaagttgttgttatgtgattggaaagtcacgggttcaagttttggaaagaacctcttatgtaaaa 5814514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 254
Target Start/End: Complemental strand, 36267897 - 36267827
Alignment:
185 ctgcgtaccatacaccaaatggtgggactcctt-cccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    |||||||| |||||||||||||| |||| | || |||||||||||  |||| ||||||| |||||||||||    
36267897 ctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg 36267827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 36602541 - 36602582
Alignment:
223 accctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| |||| ||||||| |||||||||||||||||||||    
36602541 accctgcgtatgcgggagctttagtgcaccgggttgcccttt 36602582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 21139817 - 21139761
Alignment:
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    |||||||||||||||||| ||||||||||| |||  |||| || |||| ||||||||    
21139817 tacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac 21139761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 152 - 264
Target Start/End: Complemental strand, 23619088 - 23618977
Alignment:
152 tggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    |||||||| ||||| || |||||||| |||||  || |||| ||||| ||||||||||||| ||||| |  ||| ||| | ||  |||||| |||||||     
23619088 tggaaacaacctct-gtataaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcag 23618990  T
252 cgggttgcccttt 264  Q
    |||||||||||||    
23618989 cgggttgcccttt 23618977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 101 - 133
Target Start/End: Complemental strand, 28685299 - 28685267
Alignment:
101 gcaactggtaaagttgttgtcatgtgactgaaa 133  Q
    ||||||| |||||||||||||||||||||||||    
28685299 gcaactgttaaagttgttgtcatgtgactgaaa 28685267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 138; Significance: 6e-72; HSPs: 50)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 1346924 - 1347097
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||    
1346924 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaacagggtaaggctgcgt 1347023  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
1347024 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1347097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 1354930 - 1354757
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||    
1354930 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 1354831  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
1354830 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1354757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 12222087 - 12221914
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||  ||||||||||||| ||||||||     
12222087 ttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaca 12221988  T
194 atacacca--aatggtgggactccttcccgaaccctgcatatgtgggagc-tctagtgcaccgggttgcccttt 264  Q
    ||||||||  ||||||||||| |||||||| ||||||| |||| |||||| | |||||||||||||||||||||    
12221987 atacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt 12221914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 29356033 - 29355855
Alignment:
91 taacattggcgcaactggtaaag-ttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta--aaacagggtaagactg 187  Q
    |||| ||||| |||||||||||  |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||  |||||||||||| |||    
29356033 taaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctg 29355934  T
188 cgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
29355933 cgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 29355855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 91 - 257
Target Start/End: Complemental strand, 3815252 - 3815084
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||  |||| | |||| ||||||    
3815252 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgc 3815153  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggtt 257  Q
    |||| ||||||||||||||||||| | |||||||||||| | |||| || |||| ||||||||||||||    
3815152 gtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt 3815084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 149 - 264
Target Start/End: Original strand, 26097178 - 26097293
Alignment:
149 tcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||  ||||| |||||||| |||||||||||| |||||||||||||    
26097178 tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtg 26097277  T
249 caccgggttgcccttt 264  Q
    ||||||||||||||||    
26097278 caccgggttgcccttt 26097293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 99 - 264
Target Start/End: Complemental strand, 2166579 - 2166410
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccata 196  Q
    |||||||| ||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||||||||  ||||| ||||  ||||||| |||    
2166579 gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaata 2166480  T
197 cacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||  ||||||||||| |||||||| |||||  ||||  ||||||| |||||||||||||||||||||    
2166479 caccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt 2166410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 99 - 264
Target Start/End: Complemental strand, 2178212 - 2178043
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccata 196  Q
    |||||||| ||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||||||||  ||||| ||||  ||||||| |||    
2178212 gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaata 2178113  T
197 cacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||  ||||||||||| |||||||| |||||  ||||  ||||||| |||||||||||||||||||||    
2178112 caccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt 2178043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 149 - 264
Target Start/End: Original strand, 25557743 - 25557858
Alignment:
149 tcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||  || || |||||||| |||||||||||| |||||||||||||    
25557743 tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtg 25557842  T
249 caccgggttgcccttt 264  Q
    ||||||||||||||||    
25557843 caccgggttgcccttt 25557858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 107 - 264
Target Start/End: Original strand, 9161099 - 9161259
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacca--aa 203  Q
    ||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| ||||||| ||||| |||||||| ||||| ||  ||    
9161099 ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataa 9161198  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| ||||| || ||||||| |||| || |||| ||||||||| |||||||||||    
9161199 tggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgcccttt 9161259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 109 - 264
Target Start/End: Original strand, 28007604 - 28007760
Alignment:
109 taaagttgttgtcatgtgac-tgaaatg-tcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatgg 206  Q
    |||||||||||||||||||| ||||| | |||||||||||| ||||||||| |||||||||||||||||||||| || |||||||| ||||||||||||     
28007604 taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaacagggtcaggctgcgtacaatacaccaaatgc 28007703  T
207 tgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| ||||||| || ||| |||||| || |||||||||||||||| || ||||||    
28007704 tgggaccccttccctaa-cctccatatgcggaagctctagtgcaccggattacccttt 28007760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 91 - 262
Target Start/End: Complemental strand, 15866212 - 15866041
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctctt--gtgtaaaacagggtaagactgc 188  Q
    |||| ||||| |||||||||||||||||| ||||||| ||||| |||| |||||||| ||||||||||||||||||  ||  ||||||||||||  ||||    
15866212 taaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgc 15866113  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    |||  ||||||||||||||||||| |||||||| ||||||| | || |||| || |||||||| | ||||||||    
15866112 gta--atacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct 15866041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 100 - 232
Target Start/End: Original strand, 6024202 - 6024338
Alignment:
100 cgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatac 197  Q
    |||||||||||||||||||||||||||| || || ||||||| |||||||||| |||||||||||||||||  |||||| ||||||||||||||| ||||    
6024202 cgcaactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatac 6024301  T
198 acca--aatggtgggactccttcccgaaccctgcata 232  Q
    ||||  |||| ||||||  ||||||| |||| |||||    
6024302 accaataatgatgggacctcttcccggaccccgcata 6024338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 96 - 266
Target Start/End: Complemental strand, 7947541 - 7947369
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||| |||   |||||||||| ||||| ||||||| ||||||||||| |||| |||||||||  ||||||||| ||||||||     
7947541 ttggcgcaac-ggtaaagttggtgttgcgtgactgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtaca 7947443  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    ||||||| |||||||||| | |||||||| ||| ||| |||||||||||| ||||||||  || ||||||||||    
7947442 atacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcacttggctgccctttat 7947369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 91 - 197
Target Start/End: Original strand, 8409203 - 8409311
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||| |||||||||||| ||||||| ||||| |||||||||| |||||||||||  ||||||||||||| ||||    
8409203 taaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgc 8409302  T
189 gtaccatac 197  Q
    |||| ||||    
8409303 gtacaatac 8409311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 90 - 260
Target Start/End: Complemental strand, 14975256 - 14975094
Alignment:
90 ataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    ||||| |||||||||| |||||||||||||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||| |    |||          
14975256 ataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaa---caag------ 14975166  T
190 taccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
      | ||||||||  ||||||||||| ||||||||||||| ||||||| ||||| | |||||||||||||||||    
14975165 -gcaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc 14975094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 117 - 262
Target Start/End: Complemental strand, 23240971 - 23240826
Alignment:
117 ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactcct 216  Q
    |||||| |||||||||| ||||| ||| ||| |||||||||||||||||||||||||||||||||||  ||||||| ||| ||||| ||||||||| |||    
23240971 ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgtaaaacagggtaagtttgcgtacaatataccaattggtgggacccct 23240872  T
217 tcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||  | ||  ||| |||| ||||||| |||||||| ||| ||||||    
23240871 tctaggacaatgcgtatgcgggagctttagtgcactgggctgccct 23240826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 96 - 229
Target Start/End: Complemental strand, 13905148 - 13905015
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||||||||||||||||||||| |||||||| |||| ||||| ||||  ||||||||||  ||||||||||||| |||| |||     
13905148 ttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcataca 13905050  T
194 atacaccaaatggtgggactccttcccgaaccctgc 229  Q
    || ||||||||||| |||| | ||||||||||||||    
13905049 attcaccaaatggt-ggaccctttcccgaaccctgc 13905015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 24734593 - 24734676
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||   ||||||||||| |||||| ||||||||||||||    
24734593 taacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaa 24734676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 116 - 264
Target Start/End: Complemental strand, 18277343 - 18277193
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggact 213  Q
    |||||| ||||||| ||| |||||||||||||||| |||||||||||||||||||||||  |||||||||  || ||||   |||||||||||||||||     
18277343 gttgtcctgtgactaaaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggacc 18277244  T
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||   || || | |||| ||||||| || |||||||||||| |||||    
18277243 ccttcctagactctacgtatgcgggagctttactgcaccgggttgtccttt 18277193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 91 - 227
Target Start/End: Original strand, 20400627 - 20400765
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||| ||||| |||||||||||||||||||||| ||||| ||||||| |  ||||||||  |||||||||  ||||||||||||||||||    
20400627 taaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgc 20400726  T
189 gtaccatacaccaaatggtgggactccttcccgaaccct 227  Q
    ||||  ||||| |||| | ||||| | || |||||||||    
20400727 gtacagtacactaaatagcgggacccttttccgaaccct 20400765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 91 - 212
Target Start/End: Original strand, 1941815 - 1941938
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| ||||||||||||||||||||||| |||||| || ||| ||| || || || || ||||| ||||||||||  ||||||||||||| ||||    
1941815 taaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgc 1941914  T
189 gtaccatacaccaaatggtgggac 212  Q
    |||| ||||||| |||||||||||    
1941915 gtacaatacaccgaatggtgggac 1941938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 107 - 266
Target Start/End: Original strand, 12889402 - 12889564
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||||||||||||| |||| ||||| ||||| ||||||| || || ||||||||||||||||  ||||||||| ||| |||| ||| ||||||| |||    
12889402 ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaa 12889501  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
     | |||||| |||| ||| |||||   | |||||||||| ||||||| |||| ||||||||||    
12889502 cgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcgggctgccctttat 12889564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 24097546 - 24097712
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    ||||| ||||||||||| ||| |||||||| ||||||| |||||| ||| || |||| ||| ||||||||||| |  ||||||||||||| |||| |||     
24097546 ttggcacaactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttac- 24097644  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
        ||||||||||||||| |||||||| ||||||| |||| || |||| |||||  || |||||||||||    
24097645 ---aaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgcccttt 24097712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 95 - 218
Target Start/End: Original strand, 14553476 - 14553602
Alignment:
95 attggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtac 192  Q
    ||||| ||||||||||||||||||||||||||||| ||| ||||| ||||||| ||||||||| ||| ||||||||  |||| |||||||| ||| |||     
14553476 attggtgcaactggtaaagttgttgtcatgtgact-aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtat 14553574  T
193 catacaccaaa--tggtgggactccttc 218  Q
     ||||||||||  ||||||||| |||||    
14553575 aatacaccaaaactggtgggaccccttc 14553602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 141 - 247
Target Start/End: Original strand, 32579436 - 32579543
Alignment:
141 ggttcaaatcctggaaacagcctcttgtgtaaaac-agggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtggga 239  Q
    ||||||| ||||||||||||||||| || |||||  | |||||| |||||||| |||| |||||||||||||| |||||||  |||||||||||| ||||    
32579436 ggttcaagtcctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga 32579535  T
240 gctctagt 247  Q
    ||| ||||    
32579536 gctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 23930301 - 23930127
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggtt-caaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    |||| |||||||||||  ||||| |||||||||||| || ||| |||||| ||| ||| || ||||||||| ||| ||||||||| |    |    ||||    
23930301 taaccttggcgcaactcataaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagatagttgcg 23930202  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| |||||||| |||||||||| ||||| || ||||||| |||| ||||||| |||||||||| ||||||||||    
23930201 tacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttt 23930127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 209
Target Start/End: Complemental strand, 32728314 - 32728211
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatg 205  Q
    |||||||||||||||||||||||||| ||||| | ||||| |  |||||||| |||||| |||  ||||||||||||||||| |||| ||| |||||||     
32728314 gtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaata 32728215  T
206 gtgg 209  Q
    ||||    
32728214 gtgg 32728211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 8417442 - 8417501
Alignment:
101 gcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacag 160  Q
    |||||||||||||||||||||||||||||||||||||||| |||||  || |||||||||    
8417442 gcaactggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaacag 8417501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 12063427 - 12063510
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||| ||||||| |||||||||| ||||| |||||||| ||||||||||||| |||| |||| |||||||||| |||||    
12063427 taaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaa 12063510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 12885985 - 12886048
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||||||  ||||||| |||||||||||| |||||||||||||||||||||    
12885985 aaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt 12886048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 202 - 264
Target Start/End: Original strand, 12892082 - 12892144
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||||||||||    
12892082 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 12892144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 194 - 264
Target Start/End: Original strand, 13267790 - 13267860
Alignment:
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| |||||| | ||||||| |||| |||||||  ||||||||||||||||||||    
13267790 atacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt 13267860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 107 - 263
Target Start/End: Complemental strand, 2755583 - 2755422
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaa- 203  Q
    ||||||||||||||||||||||||||| |||   ||||||| || || ||||| |||||| |    |||| ||| |||| |||||||| ||||||||||     
2755583 ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacaccaaaa 2755484  T
204 -tggtgggactccttcccgaaccctgcatat--gtgggagctctagtgcaccgggttgccctt 263  Q
     |||||||| |||||||| || |||||||||  | ||||||| ||||||||| ||||||||||    
2755483 atggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt 2755422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 97 - 264
Target Start/End: Complemental strand, 3116299 - 3116129
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtga-------ctgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    ||||||||| |||||||||||||||||||||       |||||| |||| |||||||| || |||||||| |||||||| |||||      | |||||||    
3116299 tggcgcaaccggtaaagttgttgtcatgtgagttgcgactgaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaa------atgactgcg 3116206  T
190 taccatacaccaaa--tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     || ||||||||||  ||||||||| ||||| || ||| ||| |||| ||||||| |||| |||||| |||||||||    
3116205 cacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttt 3116129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 136 - 253
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
136 tcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatat 233  Q
    |||||||||||| ||||||||||| |||||||| |  ||||||| ||||| | |||||| ||||||||||||||||||| | || ||| ||||||  |||    
33138838 tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtat 33138937  T
234 gtgggagctctagtgcaccg 253  Q
    |  | |||| ||||||||||    
33138938 gcagtagctttagtgcaccg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 91 - 167
Target Start/End: Complemental strand, 33923003 - 33922927
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttg 167  Q
    |||| |||||||||| ||||||||||||||||| ||||||||| ||||| ||||||| |||| |||||  |||||||    
33923003 taaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttcaagtcctagaaacgtcctcttg 33922927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 202 - 264
Target Start/End: Original strand, 6808468 - 6808530
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||||||| ||||||  |||| ||||||| |||||||||||||||||||||    
6808468 aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 6808530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 130 - 262
Target Start/End: Complemental strand, 15865992 - 15865859
Alignment:
130 gaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccc 226  Q
    |||| |||| |||||||| ||||||||||||||||||  ||||||   ||||||||  |||||||  ||||||||||||||||||| |||||| | ||||    
15865992 gaaaggtcatgggttcaattcctggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccc 15865895  T
227 tgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||| | || | || || |||||||| | ||||||||    
15865894 tgcgtttgcgtgatctatagtgcactgagttgccct 15865859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 96 - 178
Target Start/End: Complemental strand, 19649337 - 19649255
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagg 178  Q
    |||||||||||| |||||||||||||||||||||||||  |||||| || |||| ||| ||| |||| ||| | |||||||||    
19649337 ttggcgcaactgataaagttgttgtcatgtgactgaaagatcacggatttaaattctgaaaatagccccttatctaaaacagg 19649255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 103 - 174
Target Start/End: Complemental strand, 27855601 - 27855530
Alignment:
103 aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||| ||||||||||||||||||||| || ||| || ||| | ||||||| || |||||||||    
27855601 aactggtaaagtttttgtcatgtgactgaaatgtcgcgagtttaagtcccgaaaacagcttcctgtgtaaaa 27855530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 187 - 265
Target Start/End: Complemental strand, 383837 - 383759
Alignment:
187 gcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||| ||||||||||| ||||||| ||||| |  ||||||| |||| |||||||  ||| |||||||||||||||||    
383837 gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttta 383759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 236
Target Start/End: Original strand, 11849031 - 11849161
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaa- 203  Q
    ||||||||| |||||| |||||||||||||    ||||||| ||| ||||||| ||||||||||  |||||||| |||   |||  || ||||||||||     
11849031 ggtaaagttattgtcacgtgactgaaatgttt--ggttcaagtccaggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaaaa 11849128  T
204 tggtgggactccttcccgaaccctgcatatgtg 236  Q
    ||||||||| ||||||||||| |||| ||||||    
11849129 tggtgggaccccttcccgaactctgcgtatgtg 11849161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 155 - 264
Target Start/End: Complemental strand, 9671196 - 9671084
Alignment:
155 aaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    ||||||||||||||||||||  ||||||||| |||| |||  |||| |||| |||| |||| |||| |||||||||||| ||  ||||||| || ||||     
9671196 aaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgcat 9671097  T
252 cgggttgcccttt 264  Q
    |||| ||||||||    
9671096 cgggctgcccttt 9671084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 17432332 - 17432383
Alignment:
123 tgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||| ||||| ||||||| ||||||||||| | ||||||||||||    
17432332 tgtgactgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaa 17432383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 22967139 - 22967214
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||| ||| ||||||| |||||||||||||| || |||||  |||||| || |||||||| | ||||||||||||    
22967139 gcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaa 22967214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 23821254 - 23821179
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||| ||| ||||||| |||||||||||||| || |||||  |||||| || |||||||| | ||||||||||||    
23821254 gcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaa 23821179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 229 - 264
Target Start/End: Original strand, 25997749 - 25997784
Alignment:
229 catatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| |||||||||||||||||||||||||||||    
25997749 catatgcgggagctctagtgcaccgggttgcccttt 25997784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 4136670 - 4136609
Alignment:
113 gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||| || |||||| ||||||||||||||||| ||||  ||||| | ||||||||||||    
4136670 gttgttgccacgtgactaaaatgtcacgggttcaagtcctaaaaacaacatcttgtgtaaaa 4136609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 201 - 267
Target Start/End: Complemental strand, 16895761 - 16895693
Alignment:
201 aaatggtgggactcc-ttcccgaaccctgcatatgtgggagctctagtgcaccggg-ttgccctttata 267  Q
    |||||||||||| || |||||| ||||| ||||||||| || | |||||||||||| ||||||||||||    
16895761 aaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtttgccctttata 16895693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 30539 - 30712
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||    
30539 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaacagggtagggctgcgt 30638  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
30639 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 95)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 20224944 - 20225117
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||| ||||||||||||||||||||||| ||||||    
20224944 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaacagggtaaggctgcgt 20225043  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
20225044 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 20225117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 47528703 - 47528530
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||| ||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||    
47528703 taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 47528604  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||    
47528603 acaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgcccttt 47528530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 48598998 - 48598825
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
48598998 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 48598899  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| ||| ||||||||  ||||||||||||||||||||||||||||    
48598898 acaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttt 48598825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 11054321 - 11054148
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||    
11054321 taactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaacagggtaagactgcgt 11054222  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||| || || |||||||| |||||||||||| |||||||||||||||||||||||||||||    
11054221 acaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 11054148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 5648219 - 5648393
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||    
5648219 taaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 5648318  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| |||||||| ||||||| |||| |||||||  ||||||| ||||||||||||    
5648319 tacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttt 5648393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 91 - 263
Target Start/End: Complemental strand, 6430800 - 6430627
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||| ||||||||||||| |||||    
6430800 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggtaaggctgcg 6430701  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||| |||||||||||||||||||  ||||||| ||||||| |||| ||||||| ||| ||||||||||||||||    
6430700 tacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 6430627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 16408773 - 16408601
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    ||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||     
16408773 ttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtaca 16408674  T
194 atacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||  |||||||| || |||||||| |||| ||||||| ||||||| |||||||||||||||||||||    
16408673 atacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 16408601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 30639340 - 30639514
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||| ||||||||||||| ||||||||| |||||    
30639340 taaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggtaaggctgcg 30639439  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||| ||| |||||||| |||||||||||| ||||||| |||||||| ||||||||||||    
30639440 tacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcccttt 30639514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 5306838 - 5306660
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcg 189  Q
    |||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||||  ||||    
5306838 taaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggtaaggttgcg 5306739  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgt----gggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| |||||||| ||||||| |||||    ||||||| || ||||||||||||||||||    
5306738 tacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgcccttt 5306660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 109 - 264
Target Start/End: Complemental strand, 9832468 - 9832313
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtg 208  Q
    |||| ||||||| || ||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||    
9832468 taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtg 9832369  T
209 ggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||||| ||||||||||||  ||| ||||||||||||||||||||||||    
9832368 ggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttt 9832313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 123 - 262
Target Start/End: Complemental strand, 29208039 - 29207900
Alignment:
123 tgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccga 222  Q
    ||||||||||| ||||||||||||| |||||||||  |||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||     
29208039 tgtgactgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgg 29207940  T
223 accctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    |||||||||||| |||||||||||||||||||||||||||    
29207939 accctgcatatgcgggagctctagtgcaccgggttgccct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 112 - 260
Target Start/End: Complemental strand, 39077948 - 39077800
Alignment:
112 agttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtggga 211  Q
    |||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||| ||| ||||||||||| ||    
39077948 agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggttgcgtacaatataccaaatggtgaga 39077849  T
212 ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    |  ||| ||| |||||||||||| |||||||||||||||||||||||||    
39077848 catctttccggaccctgcatatgcgggagctctagtgcaccgggttgcc 39077800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 96 - 263
Target Start/End: Complemental strand, 8473790 - 8473621
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccat 195  Q
    |||||||||||||||||||||||||||| |||| | || ||  ||||||||| ||||||||||||||||||||||  ||||||||||| |||| ||| ||    
8473790 ttggcgcaactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgtttaacagggtaaggctgcatacaat 8473691  T
196 acaccaaatggtgggactccttccc--gaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||||||||||||||||| |||||||  || ||||||||||| ||||||| ||||||||||||||||||||    
8473690 acaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt 8473621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 90 - 261
Target Start/End: Original strand, 21646923 - 21647098
Alignment:
90 ataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactg 187  Q
    ||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||||| ||||||||||||||||||||||  |||| |||||||| |||    
21646923 ataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctg 21647022  T
188 cgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    ||||| ||| ||||  ||||||||||| |||||||  |||| ||||||| ||||||| ||||||||||||||||||    
21647023 cgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 23501753 - 23501924
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||      ||||||||||||||||||  |||||||||  |||    
23501753 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaaggttgc 23501846  T
189 gtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||||||  |||||||||| |||||||| |||||||||||| ||||||| |||||||||||||||||||||    
23501847 gtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 23501924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 104 - 263
Target Start/End: Original strand, 40915802 - 40915962
Alignment:
104 actggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaa 202  Q
    ||||||||||||||||||||||||||  || ||||||||||||| |||||||||||||||||||||| |||||| |||||| |||||||| |||||||||    
40915802 actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaa 40915901  T
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    |||||||||  |||||||| ||||||| |||| |||||||  |||||||||| ||||||||    
40915902 atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt 40915962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 16911522 - 16911699
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||||||||||||||||  ||| ||||||||| ||||    
16911522 taaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgc 16911621  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| || | ||||||| ||||  |||||||||||||||    
16911622 gtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgcccttt 16911699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 111 - 264
Target Start/End: Original strand, 54175043 - 54175200
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctgg-aaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacc-aaatggt 207  Q
    ||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||| ||||||||||||| |||||||| ||||||| |||||||    
54175043 aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggt 54175142  T
208 gggactcctt-cccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| |||| |||| |||||||||||| ||||||| |||||||||||| ||||||||    
54175143 gggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttt 54175200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 107 - 264
Target Start/End: Original strand, 35567146 - 35567305
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||||| ||||||| |||| |||||||| || ||||||||||| |||||||||||  ||||||||| ||| |||| | |||||||||    
35567146 ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaat 35567245  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||||||||||||| | || ||||||| |||||||||||| ||||||||    
35567246 ggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgcccttt 35567305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 104 - 266
Target Start/End: Complemental strand, 44363294 - 44363128
Alignment:
104 actggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc- 200  Q
    |||||||||||||||||||||||||||||| |||||| |||||| ||||| |||||||||| |||||  ||||||||||| | |||||||| |  ||||     
44363294 actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca 44363195  T
201 -aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
     |||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||||    
44363194 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttat 44363128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 106 - 264
Target Start/End: Original strand, 47443928 - 47444092
Alignment:
106 tggtaaagttgttgtcatgtgactga----aatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacac 199  Q
    ||||||||||||| ||||||||| ||    || ||||||||||||| ||||||||||||||||||| ||||||  ||||||||| |||||||| ||||||    
47443928 tggtaaagttgttctcatgtgaccgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacac 47444027  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||| |||||||| ||||||||||||  ||||||  ||||||| ||||||||||||    
47444028 caaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgcccttt 47444092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 13256572 - 13256399
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| |||| |||||||||||||||||||||||||||||| || ||||  ||||||| |||||||    |||||||||||||||  ||||||||| ||||    
13256572 taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctgga----gcctcttgtgtaaaaaacagggtaaggctgc 13256477  T
189 gtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||||||  || ||||||| ||||||||||||| |||| || ||||||| |||||||||||||||||||||    
13256476 gtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcccttt 13256399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 111 - 234
Target Start/End: Complemental strand, 17043549 - 17043424
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacaccaaatggtg 208  Q
    |||||||||||| |||||||||| ||||| ||||||| |||||||||||||||||||||||||  |||||||||| |||||||| |||||||||||||||    
17043549 aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtg 17043450  T
209 ggactccttcccgaaccctgcatatg 234  Q
    |||| |||||||  ||||||||||||    
17043449 ggaccccttcccagaccctgcatatg 17043424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 96 - 253
Target Start/End: Complemental strand, 30496490 - 30496333
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccat 195  Q
    ||||||||||||  ||||||||||||| |||||||||| |||||| |||||| || ||||||||||||||||||||||   ||||||| |||| ||| ||    
30496490 ttggcgcaactgtaaaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacacgggtaaggctgcatacaat 30496391  T
196 acaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccg 253  Q
    ||||||||||| |||||||||||||| ||| ||| ||||  |||||| ||||||||||    
30496390 acaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgcaccg 30496333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 106 - 254
Target Start/End: Original strand, 19027823 - 19027973
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||| ||||||||||| |||||||||| ||||||||||||| ||||||||||| | ||||||||  ||||||||||||| |||||||| |||||||||     
19027823 tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat 19027922  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    ||||||||| |||| ||  || |||| |||||||||||| |||||||||||    
19027923 tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg 19027973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 149 - 264
Target Start/End: Complemental strand, 20639776 - 20639658
Alignment:
149 tcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctcta 245  Q
    ||||||||||||||||||||||||||  ||||||||| |||||||| |||||||||| ||||||||| |||||||| ||||||| |||| ||||||| ||    
20639776 tcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 20639677  T
246 gtgcaccgggttgcccttt 264  Q
    |||||||||||||||||||    
20639676 gtgcaccgggttgcccttt 20639658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 91 - 212
Target Start/End: Original strand, 14590797 - 14590921
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| ||||||||||||||| |   ||||||||||||| |||    
14590797 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctg 14590896  T
188 cgtaccatacaccaaatggtgggac 212  Q
    | ||| ||||| |||||||||||||    
14590897 catacaatacatcaaatggtgggac 14590921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 135 - 264
Target Start/End: Complemental strand, 10277886 - 10277757
Alignment:
135 gtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
    |||||||||||||||||| ||||||||||||||| ||||| ||| |||| |||||||| |||||||||||||||  || |||||||  ||||||||||||    
10277886 gtcacgggttcaaatccttgaaacagcctcttgtataaaataggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatg 10277787  T
235 tgggagctctagtgcaccgggttgcccttt 264  Q
     ||||| ||||||| ||||| |||||||||    
10277786 cgggagttctagtgaaccggattgcccttt 10277757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 109 - 265
Target Start/End: Complemental strand, 30690340 - 30690175
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---------cagggtaagactgcgtaccatacac 199  Q
    |||||| ||||||| |||||||||| ||||||||||||| ||||||||| ||||||||||||||||         ||||||||| |||| ||| ||||||    
30690340 taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac 30690241  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||| ||||||||| |||||||| ||||||| |||| ||||||| ||||||||| || |||||||||    
30690240 caattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttta 30690175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 25463108 - 25463235
Alignment:
117 ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtgggactc 214  Q
    ||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||  ||||| ||| |||  ||||||| | ||||||||||||||||| |    
25463108 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccc 25463207  T
215 cttcccgaaccctgcatatgtgggagct 242  Q
    ||||||| |||||||||||| |||||||    
25463208 cttcccggaccctgcatatgcgggagct 25463235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 30352766 - 30352580
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-------aaaacagggtaag 183  Q
    |||| ||||||||||||||||||||||||||| ||||| |||| ||||||||||  | ||||||||||||||||||||||       |||||||||||||    
30352766 taaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaag 30352667  T
184 ----actgcgtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
         |||||||| |||||||  |||||||||||| ||||| || ||||||| |||| ||||||| |||||||||| ||||||||||    
30352666 taaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttt 30352580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 20405053 - 20405224
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactg 187  Q
    |||| ||| ||||||||||||||||||||||||||||||| || ||||||||       ||| |||||||||||||||||||||   |||||||||| ||    
20405053 taaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacggg-------cctagaaacagcctcttgtgtaaaaaaacagggtaagattg 20405145  T
188 cgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| |||||| ||  |||||||||| |||||||| |||| ||||||| ||||||| |||||||  ||||||||||||    
20405146 cgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcccttt 20405224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 91 - 250
Target Start/End: Original strand, 37494811 - 37494972
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| ||||||||||||||||||| |||| |||||||| ||||| ||||||| ||||||||||| ||||||||||  |||||||||||||  |||    
37494811 taaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgc 37494910  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
     ||| ||| ||||||||||||||| |||| | | ||||||| ||||  |||||| |||||||    
37494911 atacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 149 - 263
Target Start/End: Complemental strand, 7909397 - 7909281
Alignment:
149 tcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatg-tgggagctctag 246  Q
    |||||||||||| ||||||||||||| |||||||||  ||||||| ||||||||||||||||||| |||||||||||||||| ||||  ||||||| |||    
7909397 tcctggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttag 7909298  T
247 tgcaccgggttgccctt 263  Q
    |||| ||||||||||||    
7909297 tgcatcgggttgccctt 7909281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 103 - 264
Target Start/End: Original strand, 14983806 - 14983969
Alignment:
103 aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc 200  Q
    ||||||||||||||||||||| ||| || || ||||||| ||||| || | |||||||||||||||||  |||| ||||||||  ||| ||| ||||||     
14983806 aactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacact 14983905  T
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||||||| ||||||| |||| ||||||| ||||| |||  ||||||||||    
14983906 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 14983969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 25629069 - 25629184
Alignment:
151 ctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    |||||||||| ||||||||||||| |  ||||||| ||| |||| ||||||||||||||||||| |||||||| ||||| |||||| ||||||| |||||    
25629069 ctggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtg 25629168  T
249 caccgggttgcccttt 264  Q
    ||||||||||||||||    
25629169 caccgggttgcccttt 25629184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 96 - 261
Target Start/End: Original strand, 54966987 - 54967151
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||||||||||||||||||||| |||||  |||||| | ||||||| | ||||||||||  |||||||||||||  ||| |||     
54966987 ttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-taca 54967084  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    ||| ||||||||||||||| |||||||| ||||| |||||| ||||||| | |||||||||| |||||    
54967085 atataccaaatggtgggaccccttcccgtaccctacatatgcgggagct-ttgtgcaccgggctgccc 54967151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 91 - 253
Target Start/End: Original strand, 54730209 - 54730376
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| |||||||||  ||||||||||||||||||||||  ||| ||||||||||||| |||| |||||||||||||||||   |||| ||| |||| |||    
54730209 taactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctg 54730308  T
188 cgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccg 253  Q
    ||||  ||||||||  |||| ||| || |||||||| ||||||| |||| ||||||| ||||||||||    
54730309 cgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg 54730376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 97 - 242
Target Start/End: Complemental strand, 49938759 - 49938615
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccat 195  Q
    ||||||||| |  ||||||||||||| |||||||||| ||||| ||||||| |||||||||||||||||||||| ||||| |||||||   | |||| ||    
49938759 tggcgcaacggtaaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag---gtgtacaat 49938663  T
196 acacc-aaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||||| |||||||||||| |||||||  |||||||||||| |||||||    
49938662 acaccaaaatggtgggaccccttcccataccctgcatatgcgggagct 49938615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 49796818 - 49796910
Alignment:
151 ctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||||||||||||| |||||| |||||| |||||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||    
49796818 ctggaaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct 49796910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 91 - 174
Target Start/End: Complemental strand, 17315473 - 17315390
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||| |||||| ||||||||||||||    
17315473 taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaa 17315390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 114 - 220
Target Start/End: Complemental strand, 41018945 - 41018838
Alignment:
114 ttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    ||||||||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||  |||||||| || ||||| ||||||||||| |||||||    
41018945 ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggac 41018846  T
213 tccttccc 220  Q
     |||||||    
41018845 cccttccc 41018838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 96 - 228
Target Start/End: Complemental strand, 47441699 - 47441566
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| |||||||||| ||||| ||||||| |||  ||||||| ||||| |||||||  ||||||||| ||| ||||     
47441699 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtaca 47441601  T
194 atacaccaaatggtgggactccttcccgaaccctg 228  Q
    |||||||||||||| |||| |||||||| ||||||    
47441600 atacaccaaatggttggaccccttcccggaccctg 47441566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 55766641 - 55766466
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacggg-ttcaaatcctggaaacagcctcttgtgta-aaacagggtaagactgc 188  Q
    |||| ||| ||||||||||||||||||||||||||||| | || |||||||| ||||| |  |||||||||  ||||||||  |||||||||||| ||||    
55766641 taaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaacagggtaaggctgc 55766542  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||  |||||||| || || ||||| ||| ||| |||| | ||||| |||||||||||| ||||||||    
55766541 gtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgcccttt 55766466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 20908797 - 20908636
Alignment:
107 ggtaaagttgttgtcatgtgactgaaa-tgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||||||||| ||| ||  |||||| || |||||||| | |||| | ||||| ||  |||||| |||||||| ||||||||||    
20908797 ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaaa 20908698  T
204 -tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||||||||| |||||||||||||||| |||| ||||||| ||||||||  || ||||||||    
20908697 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttt 20908636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 109 - 266
Target Start/End: Complemental strand, 32478942 - 32478790
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggt 207  Q
    |||||||||||||||||||| || | ||||| ||||||| ||||||||||| ||||| |||| ||||||||||||| |||      ||||||||||||||    
32478942 taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggt 32478848  T
208 gggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    ||||| |||||||| |||| || |||| ||||||| | ||||||||||| |||||||||    
32478847 gggaccccttcccggacccagcgtatgcgggagct-ttgtgcaccgggtggccctttat 32478790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 194 - 264
Target Start/End: Original strand, 38786674 - 38786744
Alignment:
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
38786674 atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 38786744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 143 - 259
Target Start/End: Original strand, 21489099 - 21489218
Alignment:
143 ttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtggga 239  Q
    ||||| ||||||||||||||||||| ||||||  ||| |||||||||||||| || ||||||| ||||||||| |||||||||||||||| |||| ||||    
21489099 ttcaagtcctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggga 21489198  T
240 gctctagtgcaccgggttgc 259  Q
    ||| | |||||| |||||||    
21489199 gctttcgtgcactgggttgc 21489218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 94 - 189
Target Start/End: Complemental strand, 42164319 - 42164224
Alignment:
94 cattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||||||||||| |||||| |||||||||||||||||||| ||||||||||||| || |||||||| |||||||||| ||||||||||||| |||||    
42164319 cattggcgcaac-ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggtaaggctgcg 42164224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 108 - 242
Target Start/End: Complemental strand, 3580994 - 3580862
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatg 205  Q
    |||||||||||||||||||||||||| |||||| |||||| || |||||||   |||||||||||||  || |||||| ||| || | ||||||||||||    
3580994 gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtc-tggaaac---ctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatg 3580899  T
206 gtgggactccttcccgaaccctgcatatgtgggagct 242  Q
     | |||| |||||||| ||||||||||||||||||||    
3580898 ctaggaccccttcccggaccctgcatatgtgggagct 3580862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 174 - 266
Target Start/End: Original strand, 20225119 - 20225213
Alignment:
174 acagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||||||||| |||||||| |||||||||  |||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||||||||||||    
20225119 acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttat 20225213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 114 - 241
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
114 ttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtggga 211  Q
    |||||||||||||||||||| |||||||||||||  ||||||||||||||| |||||  |||| ||||||||  || || | ||||||||||||||||||    
7385628 ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtggga 7385529  T
212 ctccttcccgaaccctgcatatgtgggagc 241  Q
    | | |||||| ||||||  |||| ||||||    
7385528 ccctttcccggaccctgtgtatgcgggagc 7385499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 248
Target Start/End: Complemental strand, 30581636 - 30581481
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtac 192  Q
    |||||||||| | ||||||||||||||  | ||| ||| |||| |||||||| || |||||||| ||||||||||||||   |||||||||  || ||||    
30581636 ttggcgcaac-gctaaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtac 30581538  T
193 catacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
     |||||||||| ||||||||| |||||||| ||||||||||||| |||||| |||||    
30581537 aatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagtg 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 116 - 240
Target Start/End: Complemental strand, 32629418 - 32629293
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgt-gtaaaacagggtaagactgcgtaccatacaccaaa-tggtgggact 213  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||   ||||||||||||| | || || ||||||||||| ||| |||||     
32629418 gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggtaaggccgccta-catacaccaaattggcgggacc 32629320  T
214 ccttcccgaaccctgcatatgtgggag 240  Q
    |||||||| ||| ||| ||||||||||    
32629319 ccttcccggaccttgcgtatgtgggag 32629293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 107 - 211
Target Start/End: Complemental strand, 487294 - 487187
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtg--taaaacagggtaagactgcgtaccatacac-caaa 203  Q
    ||||||||||||||||||||||||||| ||||||||||||| || |||||||| |||||||||  ||||||| |||||  |||||||| ||||||  |||    
487294 ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaa 487195  T
204 tggtggga 211  Q
    ||||||||    
487194 tggtggga 487187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 155 - 264
Target Start/End: Complemental strand, 51865149 - 51865038
Alignment:
155 aaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    ||||||||||||||||||||  || |||||| |||||||| ||||||||||||||||| | |||||||| ||||||| |||| ||||||| || ||||||    
51865149 aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc 51865050  T
253 gggttgcccttt 264  Q
    ||  ||||||||    
51865049 ggactgcccttt 51865038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 10660364 - 10660447
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||||||||||||||||||||||||||||||||||||| || ||  |||||| ||||||||||| |||||| |||||||    
10660364 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaa 10660447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 10874509 - 10874592
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||||||||||||||||||||||||||||||||||||| || ||  |||||| ||||||||||| |||||| |||||||    
10874509 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaa 10874592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 109 - 264
Target Start/End: Complemental strand, 23580365 - 23580208
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaatg 205  Q
    |||||||||||||| |||||||||| ||||||||||||| | || |||| ||||||||||||  ||||||||| |||||||||||  ||||||| |||||    
23580365 taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatg 23580266  T
206 gtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | | ||| |||||  | | ||||  |||||||||||| |||||||||| | ||||||||    
23580265 gcgagaccccttcttgga-cctgtgtatgtgggagctttagtgcaccgagctgcccttt 23580208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 107 - 242
Target Start/End: Complemental strand, 39029220 - 39029082
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacac-caaa 203  Q
    ||||||||||||||| ||||||| ||| ||||  |||||||  | |||||||||||||||||||  ||||||||||||| ||| |||| ||||||  |||    
39029220 ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaa 39029121  T
204 tggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||  ||| ||| |||||||||||| |||||||    
39029120 tggtgggaccactttccggaccctgcatatgcgggagct 39029082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 55830896 - 55830721
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgg-gttcaaatcctggaaacagcctcttgtgta-aaacagggtaagactgc 188  Q
    |||| ||| ||||||||||||||||||||||||||||  | || ||||||| |||||| |  ||||||||| |||||||||  |||||||||||  ||||    
55830896 taaccttgacgcaactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaacagggtaatgctgc 55830797  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||  |||||||| || || ||||| ||| ||| |||| | ||||| ||||||||| || ||||||||    
55830796 gtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt 55830721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 96 - 203
Target Start/End: Original strand, 25343153 - 25343261
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    ||||||||| ||||||||||||||||| |||||||| | ||||| ||||||| | ||||||| || |||||||||  ||||||||||||| ||||||||     
25343153 ttggcgcaa-tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtaca 25343251  T
194 atacaccaaa 203  Q
    ||||||||||    
25343252 atacaccaaa 25343261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 119 - 264
Target Start/End: Original strand, 7038041 - 7038187
Alignment:
119 gtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaatggtgggactcc 215  Q
    ||||||||||||||| ||||| ||||||| |||| |||||||| ||||||||  |||| ||||||||||| ||||| ||||||| |||||||||| | ||    
7038041 gtcatgtgactgaaaggtcacaggttcaagtcct-gaaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacc 7038139  T
216 ttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | |||| ||||||| |||   |||||| |||||||| ||||||||||||    
7038140 tacccggaccctgcgtat-acggagctttagtgcactgggttgcccttt 7038187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 143 - 260
Target Start/End: Complemental strand, 9987957 - 9987838
Alignment:
143 ttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggag 240  Q
    ||||| ||||||||||| |||||||||||||  | |||||||| |||| ||| ||||||||||||||||||| ||||||   ||| |||||||| |||||    
9987957 ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag 9987858  T
241 ctctagtgcaccgggttgcc 260  Q
    || || ||||||||| ||||    
9987857 ctttaatgcaccgggctgcc 9987838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 91 - 161
Target Start/End: Complemental strand, 5313169 - 5313099
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagc 161  Q
    |||| |||||| ||||||||||||||||||||||||| ||||| ||||||||||||| ||||| |||||||    
5313169 taaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaattcctgaaaacagc 5313099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 54640508 - 54640431
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| |||||| ||||||||| ||| |||||| ||||||||||||| || |||||||||||||||||||||||    
54640508 ttggcgcaac-ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaa 54640431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 203 - 264
Target Start/End: Original strand, 32484307 - 32484368
Alignment:
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||| |||||||| |||||||||||| ||||||| |||||||||||||||||||||    
32484307 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 32484368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 107 - 172
Target Start/End: Original strand, 43035224 - 43035289
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa 172  Q
    |||||||||||||||| |||||||||| ||||||||||||| ||| ||||||| ||||||||||||    
43035224 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaa 43035289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 107 - 171
Target Start/End: Complemental strand, 12257752 - 12257688
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta 171  Q
    |||||||||||||||| |||| ||||| |||||||||||||||||| |||||||| |||||||||    
12257752 ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaaatcctagaaacagcgtcttgtgta 12257688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 202 - 265
Target Start/End: Complemental strand, 38755970 - 38755907
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||| |||||||| ||||||| |||| ||||||| ||||||||||||||||||||||    
38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 38755907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 41549358 - 41549428
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacag 177  Q
    ||||||||||||| ||  ||| ||||||||||||||||||| | ||||||||| |||||||||||||||||    
41549358 ggtaaagttgttgacacatgattgaaatgtcacgggttcaagttctggaaacaacctcttgtgtaaaacag 41549428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 200 - 265
Target Start/End: Original strand, 11394923 - 11394988
Alignment:
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||| |||| ||| ||||||| |||| ||||||| ||||||||||||||||||||||    
11394923 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 11394988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 200 - 265
Target Start/End: Original strand, 11404650 - 11404715
Alignment:
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||| |||| ||| ||||||| |||| ||||||| ||||||||||||||||||||||    
11404650 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 11404715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 96 - 261
Target Start/End: Original strand, 36589710 - 36589876
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||| |||||  ||||||||| ||| | ||||||| ||||||||||||||||||||||  |||||| |||||  |||   ||     
36589710 ttggcgcaac-ggtaaagttgatgtcacatgactgaaacgtc-caggttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgaca 36589807  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
     |||||| |||||||||||| |||||| |||||||   |||| ||||||| | |||||||||| |||||    
36589808 gtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgccc 36589876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 171 - 265
Target Start/End: Complemental strand, 48327858 - 48327762
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||||||||||||||| ||| |||||||||  ||||||||||  ||||||||||||  |||||| || || | |||||||||||||| |||||||    
48327858 aaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggttacccttta 48327762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 91 - 162
Target Start/End: Complemental strand, 20373969 - 20373898
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcc 162  Q
    |||| |||||||||||||| |||||||| |||| |||||||||||||||  |||||| |||| |||||||||    
20373969 taactttggcgcaactggtcaagttgttctcatatgactgaaatgtcacatgttcaattccttgaaacagcc 20373898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 202 - 264
Target Start/End: Complemental strand, 33836549 - 33836487
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||||||| ||||||| |||| ||||||| ||||||| |||||||||||||    
33836549 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttt 33836487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 171 - 264
Target Start/End: Complemental strand, 36816478 - 36816384
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaat-ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| | | |||||||| ||||||||||  ||||||||||||||| | ||||||  |||| ||||||| ||||| |||||||||||||||    
36816478 aaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt 36816384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 203 - 265
Target Start/End: Complemental strand, 40553998 - 40553936
Alignment:
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||| ||| |||||||| ||||||| |||| ||||||| ||||||||||||||||||||||    
40553998 atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 40553936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 202 - 266
Target Start/End: Original strand, 25388249 - 25388313
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    ||||||||||| |||||||| ||||||| ||||   ||||| |||||||||||||||||||||||    
25388249 aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgccctttat 25388313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 28494222 - 28494282
Alignment:
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||||||| |||||||  | |||||||||| |||||||||||||||||||| ||||    
28494222 caaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc 28494282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 173 - 264
Target Start/End: Original strand, 2813169 - 2813263
Alignment:
173 aacagggtaagactgcgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctct-agtgcaccgggttgcccttt 264  Q
    |||||||||||||||||||| ||||| ||  ||||||||||| | |||||||||  ||| |||| ||||||| | |||||||||| |||||||||    
2813169 aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt 2813263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 96 - 190
Target Start/End: Complemental strand, 49938608 - 49938513
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgt 190  Q
    |||||||||| |  ||||||||||||| |||||||||| ||||| | ||||| || ||||| |||| | |||||| ||||||||||||| ||||||    
49938608 ttggcgcaacggtaaaagttgttgtcacgtgactgaaaggtcacagattcaagtcttggaagcagcgtattgtgtaaaaacagggtaaggctgcgt 49938513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 35532077 - 35532127
Alignment:
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 35532127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 7227710 - 7227771
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt 170  Q
    ||||||||||||||||||||||||| |||| | |||||||| | ||||||| || |||||||    
7227710 taaagttgttgtcatgtgactgaaaagtcatgagttcaaattcaggaaacaaccgcttgtgt 7227771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 91 - 128
Target Start/End: Original strand, 18969701 - 18969738
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgac 128  Q
    |||| |||||||||||||||||||||||||||||||||    
18969701 taaccttggcgcaactggtaaagttgttgtcatgtgac 18969738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 96 - 201
Target Start/End: Original strand, 51420539 - 51420646
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtca-cgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtac 192  Q
    |||||||||| ||| |||||||||||| |||||||||| ||||   | ||||| || |||||||| ||||||||||  ||||||||||||| ||| ||||    
51420539 ttggcgcaac-ggtgaagttgttgtcacgtgactgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtac 51420637  T
193 catacacca 201  Q
     ||||||||    
51420638 aatacacca 51420646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 204 - 264
Target Start/End: Original strand, 19027986 - 19028046
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||||| ||||  | |||| ||||||| |||||||||||| ||||||||    
19027986 tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttt 19028046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 12711542 - 12711495
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttc 218  Q
    |||| ||||||||||||||||| ||||||||||||| ||||| |||||    
12711542 aaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttc 12711495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 203 - 266
Target Start/End: Original strand, 44718641 - 44718704
Alignment:
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||||||||| |||||||  ||||||| |||| ||||||| |||  ||||||||||||||||||    
44718641 atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgccctttat 44718704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 91 - 129
Target Start/End: Complemental strand, 29879672 - 29879634
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgact 129  Q
    ||||||||| ||||||| |||||||||||||||||||||    
29879672 taacattggtgcaactgataaagttgttgtcatgtgact 29879634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 96 - 158
Target Start/End: Complemental strand, 50856405 - 50856344
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaac 158  Q
    |||||||||| ||||||||||||||||  ||| ||||| ||||||||||||| |||| |||||    
50856405 ttggcgcaac-ggtaaagttgttgtcacatgattgaaaggtcacgggttcaagtcctagaaac 50856344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 56322985 - 56323035
Alignment:
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||| | ||||| ||||||| |||||||||||||||||||||    
56322985 ccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttt 56323035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 10380086 - 10379997
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtggg 210  Q
    |||||||||||| |||||  |||||| ||||  ||||| |||||||||| |||| ||| ||| | ||||||| ||||||||||| |||||    
10380086 atgtgactgaaaggtcacttgttcaagtcctacaaacaacctcttgtgtaaaaataggataaaattgcgtacaatacaccaaatagtggg 10379997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 267
Target Start/End: Complemental strand, 5313096 - 5313068
Alignment:
239 agctctagtgcaccgggttgccctttata 267  Q
    |||||||||||||||||||||||||||||    
5313096 agctctagtgcaccgggttgccctttata 5313068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 131; Significance: 9e-68; HSPs: 72)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 9671140 - 9671314
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactg-aaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcg 189  Q
    |||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9671140 taaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaaggctgcg 9671239  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
9671240 tacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 9671314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 21779434 - 21779261
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||  |||||    
21779434 taaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaacagggtaaggttgcgt 21779335  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
21779334 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 21779261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 91 - 266
Target Start/End: Original strand, 23397726 - 23397901
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||| ||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||||||| || |||    
23397726 taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctacgt 23397825  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    || ||||||||||||||||||| ||||| || ||||| |||||| |||||||||||||||||||||||||||||||    
23397826 acaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgccctttat 23397901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 8455491 - 8455316
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||  |||||||||| ||||    
8455491 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgc 8455392  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| ||||  |||||| |||||||||||||||||||||    
8455391 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcccttt 8455316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 91 - 266
Target Start/End: Original strand, 14530278 - 14530457
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |  ||||||||||||| || |    
14530278 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctac 14530377  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||||    
14530378 gtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttat 14530457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 10543658 - 10543835
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||  ||||||||||||| ||||    
10543658 taaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgc 10543757  T
189 gtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||||  |||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
10543758 gtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10543835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 25249912 - 25249738
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta-aaacagggtaagactgcg 189  Q
    |||| ||||||||| ||||||||||||||||||||||||| || ||||||||||||| || ||||||||| |||||||||| |||||||||||| |||||    
25249912 taaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggtaaggctgcg 25249813  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||  |||||||||||||||| |||| | ||||| |||||||||||||||||||||    
25249812 tacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttt 25249738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 91 - 254
Target Start/End: Complemental strand, 12024093 - 12023929
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||    
12024093 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 12023994  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    ||| ||||||||||||||||||| || ||||| ||||||| ||| ||| |||| || ||||||||    
12023993 tacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 102 - 264
Target Start/End: Original strand, 17667973 - 17668137
Alignment:
102 caactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacac 199  Q
    ||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| | ||||||||||||||  ||||||||| |||||||| ||||||    
17667973 caactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacac 17668072  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||| || ||||| |||||||||| ||| |||||||| |||||||||||||||||||||    
17668073 caaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcccttt 17668137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 101 - 264
Target Start/End: Complemental strand, 24200790 - 24200623
Alignment:
101 gcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccataca 198  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||| |||||||| |||||    
24200790 gcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaataca 24200691  T
199 cc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||  |||||||||||  |||||||| ||||||  |||||| ||||| |||||||||||||||||||||    
24200690 ccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgcccttt 24200623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 11514396 - 11514570
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||  ||||| ||||    
11514396 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgc 11514495  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||  ||||||| |||| ||||||| ||||||||||| |||||||||    
11514496 gtacaatacaccaaatggtgggac-ccttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttt 11514570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 102 - 264
Target Start/End: Original strand, 17623535 - 17623699
Alignment:
102 caactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacac 199  Q
    ||||||||||||||||||||||| ||||| || ||||||||||||| |||| |||||| ||||||||||||||  ||||||||| |||||||| ||||||    
17623535 caactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacac 17623634  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||| || |||||||||| ||||| ||||||| |||| |||||||| ||||||||||||    
17623635 caaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcccttt 17623699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 27573581 - 27573755
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta-aaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||  ||||||| ||| || |||||||||||||||| ||||| |||||| |||||    
27573581 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggtaaggctgcg 27573680  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| |||||||||||||||| ||   ||||| |||||||  |||||||||||| ||||||| |||||||||||||    
27573681 tacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgcccttt 27573755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 122 - 264
Target Start/End: Original strand, 10546153 - 10546298
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaatggtgggactccttc 218  Q
    |||||||||||| ||||||||||||| ||||||||||| |||||||| |||||   ||||||||| |||||||| ||||||||||||||||||| |||||    
10546153 atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttc 10546252  T
219 ccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||| |||| ||||||| |||||||||||||||||||||    
10546253 ccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10546298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 122 - 264
Target Start/End: Original strand, 14444720 - 14444863
Alignment:
122 atgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttccc 220  Q
    ||||||||| || ||||||||||||| |||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||||||||||| |||||||    
14444720 atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttccc 14444819  T
221 gaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | ||||||| |||| ||||||| ||||||||| |||||||||||    
14444820 ggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt 14444863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 17896219 - 17896395
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| ||| ||||||||||||||||||||||||||||| |||| ||||||| ||||| |||| |||||| ||||||||||   |||| |||||||| |||    
17896219 taaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaaggctg 17896318  T
188 cgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| ||| ||||||||||||||| ||||| || ||||||| |||||||||||| ||||||| || ||||||||||    
17896319 cgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttt 17896395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 25079893 - 25079717
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| || | |||||| ||||||||||   |||||| ||||||  ||    
25079893 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggtaaggatg 25079794  T
188 cgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| ||||||| ||||||||||| |||||||| ||||||| ||||   ||||| |||||||||||||||||||||    
25079793 cgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt 25079717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 91 - 228
Target Start/End: Original strand, 22371017 - 22371153
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||| |||||||||||||||||||||||||||||  | ||||||||||||| |||||||||||||||| |||  ||||||||||||| ||||||    
22371017 taaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgt-aaaaacagggtaaggctgcgt 22371115  T
191 accatacaccaaatggtgggactccttcccgaaccctg 228  Q
    || ||||||||||||||||||| |||||||| ||||||    
22371116 acaatacaccaaatggtgggaccccttcccggaccctg 22371153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 21377232 - 21377074
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||||||||||||||| || ||| |||||| || | |||||| ||||||||||||||  ||||||||| ||| |||| || ||||||||    
21377232 ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaat 21377133  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||||||||||||| |||||||||||| | |||||||| | ||||||||    
21377132 ggtgggaccccttcccgaaccctgcgtatgtgggagct-ttgtgcaccgagctgcccttt 21377074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 97 - 264
Target Start/End: Complemental strand, 39914475 - 39914306
Alignment:
97 tggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtacc 193  Q
    ||||||| |||||||||||||||||||||||||| || |||||||| |||| | ||||||||| ||||||||||   |||||||||||||  || ||||     
39914475 tggcgcatctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtaca 39914376  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| ||||||||||| |||||| | ||||||| |||| ||||||| ||||||| |||||||||||||    
39914375 atacaccgaatggtgggaccccttcctg-accctgcgtatgcgggagctttagtgcatcgggttgcccttt 39914306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 5840988 - 5841165
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| |||| || |||||||||||||||||||||| || ||||||||||||| |||| |||||||||| ||||||  |||| ||||||||  |||    
5840988 taaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaaggatgc 5841087  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||| ||  ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||| ||||||||||    
5841088 gtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 5841165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 91 - 252
Target Start/End: Complemental strand, 19977889 - 19977726
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||| ||||||| |||||||||||||||||| |||| ||||||||||||| | |||||||||||||||| |||  |||| ||| ||||  |||    
19977889 taaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgc 19977790  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||| ||||||||||||||||||  |||||||||||| ||  |||| ||||||| |||||||||    
19977789 gtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc 19977726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 149 - 264
Target Start/End: Original strand, 36871511 - 36871626
Alignment:
149 tcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    |||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||| |||||||| | ||||| |||| ||||||| ||||    
36871511 tcctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagt 36871609  T
248 gcaccgggttgcccttt 264  Q
    |||||||||||||||||    
36871610 gcaccgggttgcccttt 36871626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 116 - 264
Target Start/End: Original strand, 25641487 - 25641636
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactc 214  Q
    |||||||||||||||||| ||||||||||||| ||||||||||||| | |||||| ||||||||||||   ||||||| ||||||||||| ||||||| |    
25641487 gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccc 25641586  T
215 cttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| ||||| |||| | ||||| ||||| ||||| ||| |||||    
25641587 cttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtccttt 25641636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 96 - 261
Target Start/End: Complemental strand, 4516520 - 4516354
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| |||||||||| |||||   ||||| | || |||||||||||||||||  ||||||||| ||  ||||||||     
4516520 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtaca 4516422  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    ||||||||| ||||||||| |||||||| ||||||| ||||||| |||| ||||| |||||| |||||    
4516421 atacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc 4516354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 91 - 267
Target Start/End: Original strand, 14544023 - 14544204
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| ||||||||| |||||||||||||||||||||||||||| || || ||| ||  | ||||||||||||||||||||   |||||||||||||||||    
14544023 taaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaagactg 14544122  T
188 cgtaccata--caccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    ||| | |||  ||  ||||||| |||| |||||| | ||||||| |||| ||||||| |||||||||  |||||||||||||    
14544123 cgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgccctttata 14544204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 109 - 219
Target Start/End: Original strand, 5450263 - 5450376
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtaccatacaccaaatg 205  Q
    ||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||   |||||| |||||| |||||||| |||||||||| |    
5450263 taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagg 5450362  T
206 gtgggactccttcc 219  Q
    ||||||| ||||||    
5450363 gtgggaccccttcc 5450376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 106 - 266
Target Start/End: Complemental strand, 40417031 - 40416869
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||||||| || ||||||||||||| || |||||||| |||||||| |  ||||||||| ||| ||| |||| |||||||||     
40417031 tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat 40416932  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    || |||||| | ||   | |||||||||||| | ||||| |||||||||||||||||||||||    
40416931 tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgccctttat 40416869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 96 - 260
Target Start/End: Complemental strand, 24860156 - 24859992
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtacca 194  Q
    ||||||||||||||||| ||||||||||||||||| || || ||||||| ||  |||||||||| ||||| |||| |||||| ||| || |||||||| |    
24860156 ttggcgcaactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggt-aggctgcgtacaa 24860058  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||||||| | || ||||| || ||||||| |||| ||||||| ||||||||||| |||||    
24860057 tacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc 24859992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 108 - 248
Target Start/End: Complemental strand, 99421 - 99281
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggt 207  Q
    ||||||||||||||| |||||||||| ||||||||||||| |||| |||||||||||||||  |||||| || ||| |||||||| ||||||||||||||    
99421 gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtaaaaaacatggcaaggctgcgtacaatacaccaaatggt 99322  T
208 gggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    || || ||||| |  ||||||  |||| ||||||| |||||    
99321 ggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 40762349 - 40762234
Alignment:
151 ctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    |||||||||||||||||||||||| |  ||||||| || ||||| ||||||||||||||||||| | |||| | ||||||| |||||||||||| |||||    
40762349 ctggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtg 40762250  T
249 caccgggttgcccttt 264  Q
    ||||||||||||||||    
40762249 caccgggttgcccttt 40762234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 91 - 199
Target Start/End: Original strand, 7214494 - 7214604
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgc 188  Q
    |||| ||||| |||||||||||||||||||||||||||||||| |||| |||||||| || ||||||||| ||||||||||||  |||||||||| ||||    
7214494 taactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgc 7214593  T
189 gtaccatacac 199  Q
    |||| ||||||    
7214594 gtacaatacac 7214604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 99 - 264
Target Start/End: Complemental strand, 26684789 - 26684620
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacag-cctcttgtgtaaaacag---ggtaagactgcgtacca 194  Q
    ||||||||||||||||||||||||||||| ||||| ||||  |||| || ||||| |||||| |||||||||||||| |    |||||| |||||||| |    
26684789 gcgcaactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaa 26684690  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || || ||||||||||||  ||||||||||||||| |||| ||||||| || |||||||| ||| |||||    
26684689 tatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttt 26684620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 96 - 242
Target Start/End: Complemental strand, 32781457 - 32781310
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    ||||||||| ||||||||||||||  ||||  |||||| |||||| |||||| ||  ||||||| ||||||||||||||  ||||||||||||||||||     
32781457 ttggcgcaa-tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtaca 32781359  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||||||||||||||||||| |||||||  ||||||  |||| |||||||    
32781358 atacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagct 32781310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 91 - 201
Target Start/End: Original strand, 17705455 - 17705567
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa--aacagggtaagactgc 188  Q
    |||| |||| |||||||||||||||||||||||||||||  || ||||||||||||| |||||||||| |||||||||||||  ||||| ||||| |||     
17705455 taaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgt 17705554  T
189 gtaccatacacca 201  Q
    |||| ||||||||    
17705555 gtacaatacacca 17705567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 171 - 264
Target Start/End: Original strand, 25632551 - 25632644
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||| |||||||| |||||||||||||||||| ||||||||||||| | | |||| ||||||| |||||||||||||||||||||    
25632551 aaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt 25632644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 44643488 - 44643658
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtac 192  Q
    ||||||||| ||||||||||||  |||||||||||||| |||||| |||||| | || |||| ||||||||  ||||||   ||| ||||| ||||||||    
44643488 ttggcgcaa-tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtac 44643586  T
193 catacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     ||  ||||||||||||||| |||||||  ||||||| |||| ||||||  |||||||||||| ||||||||    
44643587 aatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttt 44643658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 111 - 266
Target Start/End: Complemental strand, 17380391 - 17380236
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta-aaacagggtaagactgcgtaccatacaccaaatggtgg 209  Q
    |||||||||||||||||| |||| ||||||||||||| || |||||||| ||||||||||| ||||||||||||  || || | |||||||||||| |||    
17380391 aagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatgg 17380292  T
210 gactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
     || |||||| | |||||||  ||| ||||||| | |||||||||| | ||||||||    
17380291 aaccccttcctggaccctgcggatgcgggagct-ttgtgcaccgggcttccctttat 17380236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 120 - 252
Target Start/End: Original strand, 19614981 - 19615116
Alignment:
120 tcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacca--aatggtgggactcc 215  Q
    |||||||||||||| ||||||||||||| |||| |||||| |||||||| |  |||||||||||||||||||||| ||| ||||  ||| || |||| ||    
19614981 tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggacccc 19615079  T
216 ttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||||||||||| ||||  |||||| |||||||||    
19615080 ttcccgaaccctgcgtatgcaggagctttagtgcacc 19615116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 107 - 226
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||   |||||||||| ||||||||||||| || || |||||| |||||||||  ||||||| ||||| |||||||| ||||||||| |    
23145857 ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt 23145758  T
205 ggtgggactccttcccgaaccc 226  Q
    |||||||| | |||||| ||||    
23145757 ggtgggaccctttcccggaccc 23145736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 107 - 226
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    ||||||||||||||   |||||||||| ||||||||||||| || || |||||| |||||||||  ||||||| ||||| |||||||| ||||||||| |    
23557647 ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt 23557548  T
205 ggtgggactccttcccgaaccc 226  Q
    |||||||| | |||||| ||||    
23557547 ggtgggaccctttcccggaccc 23557526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 103 - 184
Target Start/End: Original strand, 44604826 - 44604908
Alignment:
103 aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaaga 184  Q
    ||||| |||||||||||||||||||||| || ||||| ||||||| ||||||||||| |||||||||| ||||||||||||||    
44604826 aactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaga 44604908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 109 - 252
Target Start/End: Complemental strand, 31158598 - 31158451
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc--aaat 204  Q
    ||||||||||||||||||||||||| |||| ||||| || || |  ||||||||||||| ||  |||||||||||||| ||| ||| ||| |||  ||||    
31158598 taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaat 31158499  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||||| |||||||  ||||||| |||| ||||||| |||| ||||    
31158498 ggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc 31158451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 107 - 242
Target Start/End: Original strand, 33795261 - 33795398
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtac-catacaccaaa 203  Q
    |||||||||||||||| |||| ||||| ||||||||||||| ||| ||||||| ||||||| ||  ||||||||||||| ||||||||  |||||||  |    
33795261 ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc-ta 33795359  T
204 tggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||||||||| |||||||  ||||||  |||| |||||||    
33795360 tggtgggaccccttcccagaccctgtgtatgcgggagct 33795398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 30826058 - 30826158
Alignment:
152 tggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    ||||||||||||||||||| |||| ||||||||  ||||||| |||||||||||||||| || |||||||  ||||| |||||| ||||||| |||||||    
30826058 tggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggtggaac-ccttcccagaccctacatatgcgggagctttagtgca 30826156  T
251 cc 252  Q
    ||    
30826157 cc 30826158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 44521532 - 44521417
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    |||||||||||| ||| |||||||||| |||||| ||||||||| ||||||||  |||||||||  |||||| |||||| |||| ||  |||||||||||    
44521532 ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaat 44521433  T
205 ggtgggactccttccc 220  Q
    || ||||  |||||||    
44521432 ggcgggagcccttccc 44521417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 29420048 - 29419981
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||||||  ||||||||| |||||| |||||| ||||||||||| ||||||||||||||    
29420048 ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaa 29419981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 135 - 263
Target Start/End: Complemental strand, 13245217 - 13245096
Alignment:
135 gtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatg 234  Q
    |||||| |||||| ||||||||||| ||||||||||       |||||| ||||||||  ||||| |||||||||||| |||||||| ||| |||||||     
13245217 gtcacgagttcaagtcctggaaacaacctcttgtgt-------ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatata 13245125  T
235 tgggagctctagtgcaccgggttgccctt 263  Q
     ||||||| ||||| | ||||||||||||    
13245124 cgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 91 - 133
Target Start/End: Complemental strand, 27466305 - 27466263
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaa 133  Q
    |||||||||||||||||||||||||||||||||||||||||||    
27466305 taacattggcgcaactggtaaagttgttgtcatgtgactgaaa 27466263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 127 - 254
Target Start/End: Original strand, 17471544 - 17471675
Alignment:
127 actgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtaccatacacc-aaatggtgggactccttcccga 222  Q
    ||||||||||||| ||||||| ||   |||||||||||||||||   |||||||| ||||||||||||| ||| ||| ||||| || ||| |||||||      
17471544 actgaaatgtcacaggttcaagtctcagaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctg 17471643  T
223 accctgcatatgtgggagctctagtgcaccgg 254  Q
    ||||||| |||| ||||| | |||||||||||    
17471644 accctgcctatgcgggagttttagtgcaccgg 17471675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 204 - 264
Target Start/End: Original strand, 34080176 - 34080236
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| |||||||| |||||||||||| ||||| | |||||||||||||||||||||    
34080176 tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcccttt 34080236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 203 - 262
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    |||||||||| |||||||| |||||||||||| |||||||  ||||||||||||||||||    
41409936 atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct 41409995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 208
Target Start/End: Complemental strand, 2003678 - 2003592
Alignment:
125 tgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtaccatacaccaaatggtg 208  Q
    ||||||||| ||||||||| ||| |||||||||||||| |||| ||   |||||||||||||  ||||||| ||||| |||||||||    
2003678 tgactgaaaggtcacgggtacaagtcctggaaacagccccttgcgtaaaaaaacagggtaaggatgcgtacaatacaacaaatggtg 2003592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 209 - 265
Target Start/End: Original strand, 8575975 - 8576031
Alignment:
209 ggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||| |||||||| ||||||| |||||||||||| ||||||||| ||||||||||||    
8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttta 8576031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 140 - 264
Target Start/End: Complemental strand, 15296533 - 15296406
Alignment:
140 gggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacc-aaatggtgggactccttcccgaaccctgcatatgtg 236  Q
    |||||||| ||| ||||||||||| |||||||||  |||||||||| |||||||| ||| ||| |||| ||||||  ||||| || ||||||| ||||||    
15296533 gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtg 15296434  T
237 ggagctctagtgcaccgggttgcccttt 264  Q
    | |||| | |||| || || ||||||||    
15296433 gaagctttggtgcgccaggctgcccttt 15296406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 116 - 252
Target Start/End: Complemental strand, 31821491 - 31821355
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactcc 215  Q
    ||||| |||||||||||| |||||| |||||| || | |||||||||   |||  |||| ||||||||  || |||| |||||||||||| |||||| ||    
31821491 gttgttatgtgactgaaaggtcacgagttcaagtcgtagaaacagccgtgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccc 31821392  T
216 ttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    || ||||| ||||  |||| ||||||| || ||||||    
31821391 tttccgaaacctgtgtatgcgggagctttaatgcacc 31821355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 91 - 131
Target Start/End: Complemental strand, 39189596 - 39189556
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactga 131  Q
    |||| ||||||||||||||||||||||||||||||||||||    
39189596 taaccttggcgcaactggtaaagttgttgtcatgtgactga 39189556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 203 - 263
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
203 atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    |||||||||| |||||||| ||||||  |||| ||||||| ||||||||||||||||||||    
40579810 atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 23488555 - 23488618
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||| |||||||| ||||||| |||| | ||||| |||||||||||||||| ||||    
23488555 aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctcttt 23488618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 96 - 162
Target Start/End: Original strand, 35017783 - 35017849
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgac-tgaaatgtcacgggttcaaatcctggaaacagcc 162  Q
    |||||||||| |||||||||||||||||||||| ||||| |||||||||| || ||||| ||||||||    
35017783 ttggcgcaac-ggtaaagttgttgtcatgtgacttgaaaggtcacgggtttaagtcctgaaaacagcc 35017849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 130 - 219
Target Start/End: Complemental strand, 12315787 - 12315697
Alignment:
130 gaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcc 219  Q
    |||| |||||| |||||| || |||||||||| |||| |  |||| ||||||||||||| |||| ||||||||||| ||| ||||||||||    
12315787 gaaaggtcacgagttcaagtcatggaaacagcttcttattaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactccttcc 12315697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 194 - 256
Target Start/End: Original strand, 31523296 - 31523358
Alignment:
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggt 256  Q
    |||||||||||||||| || | ||||| ||||||||||||| ||||||| |||||||| ||||    
31523296 atacaccaaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt 31523358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 39189554 - 39189508
Alignment:
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    |||||||| |||| ||||||| |||||||||||||||||||||||||    
39189554 ccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcc 39189508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 174
Target Start/End: Complemental strand, 45235976 - 45235910
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||| ||||||||||||||  ||||| |||||| |||| ||||||| ||||| |||||||    
45235976 gtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaa 45235910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 4794871 - 4794924
Alignment:
198 accaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    |||||||| |||||| |||||||| | |||||||||| ||||||||||||||||    
4794871 accaaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac 4794924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 216 - 264
Target Start/End: Original strand, 22371199 - 22371247
Alignment:
216 ttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| ||||||| |||| ||||||| |||||||||||||||||||||    
22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 22371247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 116 - 174
Target Start/End: Complemental strand, 4852364 - 4852306
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||| |||| |||| |||||||| ||||| |||||| |||||||| ||||    
4852364 gttgtcatgtgaccgaaaagtcaggggttcaagtcctgcaaacagtctcttgtgaaaaa 4852306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 194 - 248
Target Start/End: Complemental strand, 24059066 - 24059012
Alignment:
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    |||||||| |||||||||| |||| ||| ||||||| |||||||||||| |||||    
24059066 atacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtg 24059012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 34752820 - 34752759
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtg 169  Q
    ||||| ||||| |||||||||||||| ||||||  ||||| | ||||||||| |||||||||    
34752820 gtaaacttgttatcatgtgactgaaaggtcacgaattcaagttctggaaacaacctcttgtg 34752759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 171 - 252
Target Start/End: Complemental strand, 39499323 - 39499242
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||| |||||||  |||||||| ||||| ||||||||||||  ||||  |||| ||||| |||| ||||||| |||||||||    
39499323 aaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc 39499242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 216 - 260
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
216 ttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    |||||| ||||||| |||| ||||||| |||||||||||||||||    
124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 124918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 30864530 - 30864474
Alignment:
152 tggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggt 207  Q
    ||||||||||||||||||| |||| ||||||||  ||||||| ||| ||||||||||    
30864530 tggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggt 30864474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 130; Significance: 4e-67; HSPs: 78)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 1217072 - 1217245
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||| ||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
1217072 taaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 1217171  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||| ||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
1217172 acaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1217245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 91 - 263
Target Start/End: Complemental strand, 22123090 - 22122918
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||| ||||||||| |||||||||||||||||||| ||| ||||||||| |||||||||||| |||||||||||||||||||||| ||||||    
22123090 taaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaaggctgcgt 22122991  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    || ||||||||||||||||||| |||||||| |||||||||||| | ||||||||||||||||||||||||||    
22122990 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt 22122918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 91 - 265
Target Start/End: Original strand, 39203498 - 39203672
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||| ||||| |||||||||||||||||||||||||| ||||| ||||||| |||| ||||||||||||||||||||||||||||||  |||||    
39203498 taaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaacagggtaaggttgcgt 39203597  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    || ||||||||||||||||||| |||||||| ||| |||||||| ||||||| ||||||||||||||||||||||    
39203598 acaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttta 39203672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 40272987 - 40272812
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || |||| |||||||| ||||||||||| ||||||||||||||  ||||||||| ||||    
40272987 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgc 40272888  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
40272887 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40272812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 91 - 263
Target Start/End: Complemental strand, 7697060 - 7696893
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||    
7697060 taaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaaggctgcgt 7696961  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    || |||||||||||||     | |||||||| || |||||||||||||||||||||||||||||||| |||||    
7696960 acaatacaccaaatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccgggtttccctt 7696893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 13730779 - 13730602
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||  ||||||||||||| |||     
13730779 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgt 13730680  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||||||||||    
13730679 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 13730602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 138 - 264
Target Start/End: Original strand, 31592878 - 31593004
Alignment:
138 acgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgg 237  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||| ||    
31592878 acgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgg 31592977  T
238 gagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||||||||||||||    
31592978 gagctctagtgcaccgggttgcccttt 31593004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 13628968 - 13628790
Alignment:
91 taacattggcgcaactggtaaa-gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta--aaacagggtaagactg 187  Q
    |||| ||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||  |||||||||||| |||    
13628968 taaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctg 13628869  T
188 cgtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
13628868 cgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 13628790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 93 - 264
Target Start/End: Original strand, 26869691 - 26869863
Alignment:
93 acattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgta 191  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |||| ||||||||||||| |||||||    
26869691 acatcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggtaaggctgcgta 26869790  T
192 ccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | ||||||||||||||||||| |||| ||| ||| ||| |||| ||||||| | |||||||||||||||||||    
26869791 caatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcccttt 26869863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 29366897 - 29366720
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||| ||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||| |  ||||||||||||| ||||    
29366897 taaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgc 29366798  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| |||||||||||| |||||||| ||||||||||||    
29366797 gtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcccttt 29366720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 91 - 262
Target Start/End: Complemental strand, 8247864 - 8247688
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||  |||||||||||||  |||    
8247864 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgc 8247765  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctct-agtgcaccgggttgccct 262  Q
    |||| ||||||||  |||||||||||||||||||| ||||||| |||| ||||||| | ||||||| ||||||||||    
8247764 gtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct 8247688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 46421212 - 46421034
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||    
46421212 taaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 46421113  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctct-agtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||||| | |||||||||| |||||||||    
46421112 gtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgcccttt 46421034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 52926385 - 52926219
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||       ||||| ||||||    
52926385 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta-------gtaaggctgcgt 52926293  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| ||||||| |||| ||||||| ||| |||||||||||||||||    
52926292 acaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttt 52926219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 16735423 - 16735597
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgt-gtaaaacagggtaagactgcg 189  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||||| | ||||||||||||| |||||    
16735423 taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcg 16735522  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| |||||||| || |||| |||| || ||||  ||||||| ||||||||||||    
16735523 tacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttt 16735597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 91 - 263
Target Start/End: Original strand, 22609749 - 22609921
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcg 189  Q
    |||| |||||||||| |||||||||||||||||||||||| || || |||||||||| || ||||||||||||||||||||||| ||||||||| |||||    
22609749 taaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcg 22609847  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    ||| ||||||||||||||||||| |||||||| ||| ||| |||| |||||||  |||||||||||||||||||    
22609848 tacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 12914210 - 12914035
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||| ||||||| |||| |||||  |||||| ||||||||||||||||||||||  ||||||||||||| | ||    
12914210 taaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggc 12914111  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||| ||| |||||||  |||||||||||| |||||||  | ||||||||||||||||||    
12914110 gtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcccttt 12914035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 108 - 264
Target Start/End: Complemental strand, 34420802 - 34420643
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaat 204  Q
    ||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||| |||||||||||||||| ||||    
34420802 gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaat 34420703  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||||| ||| ||| |||||||||||| ||||||||  || ||||||||    
34420702 ggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggctgcccttt 34420643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 158 - 264
Target Start/End: Original strand, 15797271 - 15797377
Alignment:
158 cagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggtt 257  Q
    |||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
15797271 cagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggtt 15797370  T
258 gcccttt 264  Q
    |||||||    
15797371 gcccttt 15797377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 96 - 262
Target Start/End: Original strand, 26573115 - 26573282
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||| |||||  ||||||||||||| ||||||||     
26573115 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtaca 26573213  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||||||||| ||||||||| || ||||| ||||||| |||| | ||||| ||||||||| || ||||||    
26573214 atacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct 26573282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 91 - 253
Target Start/End: Complemental strand, 6411996 - 6411833
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| ||| |||||||||||||||||||||||||| ||||| | |||| |||||||| || || |||||||||||||||| ||||||||||||| |||||    
6411996 taaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggtaaggctgcg 6411897  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccg 253  Q
    ||| |||||||||||| |||||| |||||||  ||| ||| |||| ||||||| ||||||||||    
6411896 tacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg 6411833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 91 - 191
Target Start/End: Complemental strand, 10870126 - 10870025
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||    
10870126 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 10870027  T
190 ta 191  Q
    ||    
10870026 ta 10870025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 117 - 264
Target Start/End: Original strand, 516417 - 516569
Alignment:
117 ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc---aaatggtggga 211  Q
    ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||  ||||||||||||| ||||| || ||| |||   |||||| ||||    
516417 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga 516516  T
212 ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | |||||||  ||||||| |||| ||||||| |||||||||||||||||||||    
516517 ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 516569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 5173896 - 5173719
Alignment:
91 taacattggcgcaactggtaaa-gttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgc 188  Q
    |||| ||||||||||| ||||| ||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||| ||  |||||  |||    
5173896 taaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagtaaggttgc 5173797  T
189 gtaccatacaccaaa--tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     | | ||||||||||  ||||||| | |||||||| ||| ||| |||| ||||||| |||||||||||||||||||||    
5173796 atgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt 5173719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 159 - 264
Target Start/End: Original strand, 26292382 - 26292487
Alignment:
159 agcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttg 258  Q
    ||||||||||||||||||||||||||| |||||| |||||||||||| |||||  ||||||||||||||||||||| |||| ||||||||||||||||||    
26292382 agcctcttgtgtaaaacagggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttg 26292481  T
259 cccttt 264  Q
     |||||    
26292482 tccttt 26292487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 167 - 264
Target Start/End: Complemental strand, 34771461 - 34771364
Alignment:
167 gtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||| ||||||||    
34771461 gtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttt 34771364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 53996725 - 53996565
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaa 203  Q
    |||||| |||||||||| ||||||||| |||||| |||||| || |||||||| ||||||||||  ||||||||||||| |||| ||| ||||||| |||    
53996725 ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaa 53996626  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| |||||||  || |||| |||||||||||| |||||||||||| ||||||||    
53996625 tggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttt 53996565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 99 - 212
Target Start/End: Complemental strand, 4495831 - 4495716
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccata 196  Q
    |||||||||||||||||||||||||||||||| || ||||||||||||| ||||| ||| ||||| ||||||  ||||||||||||| |||||||| |||    
4495831 gcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaata 4495732  T
197 caccaaatggtgggac 212  Q
    ||||||||||||||||    
4495731 caccaaatggtgggac 4495716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 149 - 264
Target Start/End: Original strand, 54484730 - 54484848
Alignment:
149 tcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctcta 245  Q
    ||||||||||||||||||||||||||   || |||||| |||||||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| ||    
54484730 tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 54484829  T
246 gtgcaccgggttgcccttt 264  Q
    |||||||||||||||||||    
54484830 gtgcaccgggttgcccttt 54484848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 91 - 247
Target Start/End: Original strand, 9607185 - 9607345
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||| |||||||||||||||||||||||||| ||||  ||||||| ||||||||||||||||||| ||  ||||||||||||| ||||    
9607185 taaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgc 9607284  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    |||  ||||||||  |||| |||||| |||||||  |||| ||||||| ||||||| ||||    
9607285 gtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 111 - 242
Target Start/End: Complemental strand, 30928302 - 30928169
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtg 208  Q
    ||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||  |||||| ||||||  || |||  ||||||||| ||| |    
30928302 aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcg 30928203  T
209 ggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||| |||||||| ||||||||||||||||||||    
30928202 ggaccccttcccggaccctgcatatgtgggagct 30928169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 96 - 211
Target Start/End: Complemental strand, 45620998 - 45620881
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactgcgtac 192  Q
    |||||||||| |||||||||||||||| |||||||||| ||||||||||||| | ||||||||||||||||||||   ||||||||||||| ||||||||    
45620998 ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtac 45620900  T
193 catacaccaaatggtggga 211  Q
     ||||||||| ||||||||    
45620899 aatacaccaattggtggga 45620881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 112 - 260
Target Start/End: Original strand, 7942993 - 7943143
Alignment:
112 agttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgg 209  Q
    ||||||||||||||||||| || ||||||| ||||| ||||||||||||| |||||| |||||  |||||||||||||||||| ||||| ||||||||||    
7942993 agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgg 7943092  T
210 gactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||  |||| ||  ||| ||| |||| ||||||| |||||||| ||||||||    
7943093 gatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc 7943143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 137 - 265
Target Start/End: Complemental strand, 10795554 - 10795422
Alignment:
137 cacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacc--aaatggtgggactccttcccgaaccctgcata 232  Q
    ||||||||||| |||||||||||||||||||||||||  |||||||||| |||||||| |||||||  |||||||||||| |||||| | ||||||| ||    
10795554 cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta 10795455  T
233 tgtgggagctctagtgcaccgggttgcccttta 265  Q
    || |||||||  |||||||| ||||||||||||    
10795454 tgcgggagcttcagtgcaccaggttgcccttta 10795422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 96 - 254
Target Start/End: Complemental strand, 45949010 - 45948848
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaa---atgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgt 190  Q
    |||||||||| ||| |||||||| |||||||||||||   | ||||||||||||| ||||||||||| |||||||||||||| |  ||||||| |||| |    
45949010 ttggcgcaac-ggtgaagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcat 45948912  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    || ||||||||| ||||||||| ||||| || ||||||| |||| ||||||| |||||||||||    
45948911 acaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 141 - 264
Target Start/End: Original strand, 14986989 - 14987116
Alignment:
141 ggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtg 236  Q
    ||||||| ||||||||||||||||||||||||||  ||||||||| |||||||| |||||||||  |||||||||| | |||||| ||| |||||||| |    
14986989 ggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg 14987088  T
237 ggagctctagtgcaccgggttgcccttt 264  Q
    |||||| |||||||||||||| ||||||    
14987089 ggagctttagtgcaccgggtttcccttt 14987116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 108 - 264
Target Start/End: Original strand, 25944468 - 25944627
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaat 204  Q
    ||||||||||||||| |||||||||| |||| |||||||| |||||||||| |||||| ||||  ||||| ||| ||| ||| |||| ||||||| ||||    
25944468 gtaaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaat 25944567  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||||  ||||||| |||||||||||| ||| ||||| || ||||||||    
25944568 ggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgcccttt 25944627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 90 - 264
Target Start/End: Complemental strand, 25517349 - 25517170
Alignment:
90 ataacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaat--cctggaaacagcctcttgtgtaaaa---cagggtaaga 184  Q
    ||||| ||||||||||||||||||||||||||||||||||| || ||||| || | |     |||||||||| ||||||||||||||   || | || |     
25517349 ataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagatatgg 25517250  T
185 ctgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||| |||||||||||| |||||||| | ||||| ||||  |||||| |||||||||||||||||||||    
25517249 ctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcccttt 25517170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 120 - 248
Target Start/End: Original strand, 33926094 - 33926224
Alignment:
120 tcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacca-aatggtgggactcctt 217  Q
    |||||||||||||| |||| |||||||| ||||||||| |||||||||||| ||||||||||||| ||| |||| |||||||| ||||||||||| ||||    
33926094 tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggacccctt 33926193  T
218 cccgaaccctgcatatgtgggagctctagtg 248  Q
    || | |||||||||||| | ||||| |||||    
33926194 cctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 152 - 264
Target Start/End: Complemental strand, 49013589 - 49013473
Alignment:
152 tggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    |||||||||||||||||||||||  ||||||||| |||||||| |||||||||  |||||||||| |||||||| |||| ||||| | ||||||| ||||    
49013589 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagt 49013490  T
248 gcaccgggttgcccttt 264  Q
    |||||||||||||||||    
49013489 gcaccgggttgcccttt 49013473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 155 - 266
Target Start/End: Complemental strand, 45786327 - 45786212
Alignment:
155 aaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaa--tggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    ||||||||||||||||||||  ||||||||| |||||||| ||||||||||  ||||||||| |||||||| |||||||  |||  |||||| |||||||    
45786327 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca 45786228  T
251 ccgggttgccctttat 266  Q
    ||||||||||||||||    
45786227 ccgggttgccctttat 45786212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 54374488 - 54374357
Alignment:
124 gtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtaccatacaccaaa-tggtgggactccttccc 220  Q
    |||||||||| ||||| ||||||| || |||||||| |||||||||||||| |  ||||||| |||||||| || ||||||| ||||||||| |||||||    
54374488 gtgactgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttccc 54374389  T
221 gaaccctgcatatgtgggagctctagtgcacc 252  Q
    | |||||||||||| ||||||| |||| ||||    
54374388 ggaccctgcatatgcgggagctttagttcacc 54374357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 171 - 262
Target Start/End: Complemental strand, 353444 - 353351
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    ||||||||||||| |||||||| |||||||||  |||||||||| |||||||| |||| ||||||| ||||||| |||||||||||||||||||    
353444 aaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 35417904 - 35417981
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| |||||||||||| |||||||||||| | |||||| |||||||||||||||||||||||||||||||||    
35417904 ttggcgcaac-ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaa 35417981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 105 - 212
Target Start/End: Original strand, 33235526 - 33235637
Alignment:
105 ctggtaaagttgttgtcatgtgac-tgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactgcgtaccatacacc 200  Q
    |||||||||||||||||||||||| ||||| |||||  ||||||||| || ||| ||||||||||||||||   ||||||||||||| |||| ||||||     
33235526 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacact 33235625  T
201 aaatggtgggac 212  Q
    ||||||||||||    
33235626 aaatggtgggac 33235637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 120 - 212
Target Start/End: Complemental strand, 54032705 - 54032611
Alignment:
120 tcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    ||||||||||| || ||||||||||||| ||||||||||| ||||||||||  ||||||||||||| |||| ||| ||||||| |||||||||||    
54032705 tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtgggac 54032611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 111 - 198
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa--aacagggtaagactgcgtaccataca 198  Q
    ||||||| || |||||||||||||||||||||||||| ||||||||| | ||||||||||||  |||| ||||||||||||||| |||||    
39211992 aagttgtcgttatgtgactgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca 39212081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 155 - 228
Target Start/End: Original strand, 47624088 - 47624162
Alignment:
155 aaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctg 228  Q
    |||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||| |||||||| ||||||    
47624088 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg 47624162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 151 - 266
Target Start/End: Original strand, 31831241 - 31831345
Alignment:
151 ctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    |||||||||||||||||||||||| |||||||| |||| ||| ||||||||||||||           ||| |||||||||||| ||| |||||||||||    
31831241 ctggaaacagcctcttgtgtaaaatagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgca 31831329  T
251 ccgggttgccctttat 266  Q
    ||||||||||||||||    
31831330 ccgggttgccctttat 31831345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 107 - 181
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggta 181  Q
    ||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||| |||||  |||||||||||    
53062036 ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta 53062112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 204 - 264
Target Start/End: Original strand, 30452892 - 30452952
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
30452892 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30452952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 91 - 189
Target Start/End: Original strand, 12525392 - 12525489
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||   ||| ||||||||| ||||| ||||| | ||||||||||||||||||||||||||  ||||||||| ||||    
12525392 taaccttggcgcaactggtaaagttgt---catatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgc 12525488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 198 - 264
Target Start/End: Complemental strand, 24851367 - 24851301
Alignment:
198 accaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||| |||||||| | |||||||||| ||||||| |||||||||||||||||||||    
24851367 accaaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttt 24851301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 220
Target Start/End: Complemental strand, 45139624 - 45139520
Alignment:
120 tcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacc--aaatggtgggactcc 215  Q
    |||||||||||||| ||||||||||||| |  |||||||| |||||||||||||  |||||||||| |||| ||| |||||||  |||||||||||| ||    
45139624 tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc 45139525  T
216 ttccc 220  Q
    |||||    
45139524 ttccc 45139520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 107 - 260
Target Start/End: Original strand, 19731000 - 19731155
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaat 204  Q
    |||||| ||||||||| |||| ||||| ||||||| | ||| ||||||||| ||||||||||||  |||||| ||||||  ||||||| ||||||| | |    
19731000 ggtaaatttgttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctatt 19731099  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    |||||||| | |||||  || |||  ||||  |||||| |||||||||||| ||||    
19731100 ggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc 19731155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 91 - 204
Target Start/End: Original strand, 21875002 - 21875111
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| ||| |||||||||||||||||||||||||||||||       |||||||||||| ||||||||| ||||||||||   |||| |||||||| |||    
21875002 taaccttgacgcaactggtaaagttgttgtcatgtgactg-------acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctg 21875094  T
188 cgtaccatacaccaaat 204  Q
    ||||| |||||| ||||    
21875095 cgtacaatacactaaat 21875111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 24578007 - 24578082
Alignment:
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||| |||||||||||||| |||||  ||||| |||||| |||| ||||||||||||||||||||||||    
24578007 gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttt 24578082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 141 - 272
Target Start/End: Original strand, 55401208 - 55401342
Alignment:
141 ggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacacc-aaatggtgggactccttcccgaaccctgcatatgtgg 237  Q
    ||||||| ||||| ||||||||||||||||  |||||||| ||||||||||||  ||||||| |||||||||||| ||||| || ||| | | |||| ||    
55401208 ggttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgg 55401307  T
238 gagctctagtgcaccgggttgccctttataggtat 272  Q
    ||||| |  ||||||||| |||| ||||| |||||    
55401308 gagcttttttgcaccgggctgccttttatgggtat 55401342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 96 - 254
Target Start/End: Complemental strand, 829611 - 829452
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||||||| |||| ||||| | | || |||||| | || |||||| |||||||| ||||  |||  ||||   |||||||     
829611 ttggcgcaac-ggtaaagttgttgtcacgtgattgaaa-gacccgagttcaagttctagaaacaacctcttgtctaaagaacatagtaaagttgcgtaca 829514  T
194 atacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    |||||||||| ||||||||| |||||||||||||||| ||||  |||||| |||||||||||    
829513 atacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg 829452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 149 - 264
Target Start/End: Complemental strand, 50625070 - 50624953
Alignment:
149 tcctggaaacagcctcttgtgta--aaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctag 246  Q
    |||| ||||||||||||||||||  ||| ||||||||   |||||| ||||||||  ||||||||| |||||| |  |||||| || ||||||||| |||    
50625070 tcctagaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttag 50624971  T
247 tgcaccgggttgcccttt 264  Q
    ||||||||| ||||||||    
50624970 tgcaccgggctgcccttt 50624953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 8411016 - 8410919
Alignment:
115 tgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    |||||||||| |||||||| ||||| ||||||  |||||||||| ||||| |||  ||||||||||||| ||||  || ||||||||| |||||||||    
8411016 tgttgtcatgggactgaaaggtcaccggttcaggtcctggaaactgcctcgtgtaaaaaacagggtaaggctgctcacaatacaccaactggtgggac 8410919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 107 - 265
Target Start/End: Original strand, 28904941 - 28905101
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa---aacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||||||||||||||| ||| |||||  ||| || ||| || ||||| |||||||||||   |||| |||||||||| ||||  |||||||||    
28904941 ggtaaagttgttgtcatgtgactaaaaagtcacatgtttaagtccagggaacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaa 28905040  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |  |||||| | |||||| ||||||| || | |||| || ||||| | |||| |||||||||    
28905041 t-atgggaccctttcccggaccctgcgtaagcgggaactttagtgtaacgggctgcccttta 28905101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 265
Target Start/End: Original strand, 9276313 - 9276420
Alignment:
158 cagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    |||||||||||||||||  ||||||||| |||||||| |||||||||||||| |||| | |||||| ||||||| |||| |||| || || ||| | |||    
9276313 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcaggg 9276410  T
256 ttgcccttta 265  Q
    ||||||||||    
9276411 ttgcccttta 9276420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 31904974 - 31904909
Alignment:
149 tcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    ||||||||||||||| || |||||||  ||||||| |||||||||| |||||||||||||||||||    
31904974 tcctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggac 31904909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 107 - 260
Target Start/End: Complemental strand, 44403715 - 44403559
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccata-caccaaa 203  Q
    ||||||||| |||||| ||| || ||| ||||| |||| || |||||| || |||||||||||||||  ||| |||||| ||||| |  ||| ||| |||    
44403715 ggtaaagttattgtcacgtggctaaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaa 44403616  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||| |||||||| ||||| | ||||  | |||| |||||||||||| ||||    
44403615 tggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgcc 44403559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 52428616 - 52428532
Alignment:
128 ctgaaatgtcacgggttcaaatc-ctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgg 209  Q
    |||||| |||||||||| || || |||||| |||||||||||||||||  ||||||||| |||||||| ||||||||||| ||||    
52428616 ctgaaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtgg 52428532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 212
Target Start/End: Original strand, 19751576 - 19751683
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaat 204  Q
    |||||| || |||||| |||| ||||| ||||||| | ||| ||||||||| ||||||||||||||||  || ||||||  ||||||| ||||||| | |    
19751576 ggtaaattttttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctatt 19751675  T
205 ggtgggac 212  Q
    ||||||||    
19751676 ggtgggac 19751683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 24577917 - 24577992
Alignment:
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||| |||||||||||  | |||||  |||||||||||  ||||||||||||||||||| |||||||||    
24577917 gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttt 24577992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 26782348 - 26782431
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| ||| ||||| |||||||||| |||||||| || ||||| ||||||| ||||| |||| ||||||  |||||||||||||    
26782348 taaccttgacgcaattggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaa 26782431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 142 - 250
Target Start/End: Complemental strand, 43114994 - 43114882
Alignment:
142 gttcaaatcctggaaacagcctcttgtgt---aaaacagggtaa-gactgcgtaccatacaccaaatggtgggactccttcc-cgaaccctgcatatgtg 236  Q
    |||||| ||||||||||||||||||||||   |||||||||||| | || | ||| ||||||||||||||||||| ||||||  || |||||| |||| |    
43114994 gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggac-ccttcctggacccctgcgtatgcg 43114896  T
237 ggagctctagtgca 250  Q
    |||||| |||||||    
43114895 ggagctttagtgca 43114882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 6242331 - 6242285
Alignment:
218 cccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||  ||||||||||||||||||||||||||||    
6242331 cccggaccctgcatatgcaggagctctagtgcaccgggttgcccttt 6242285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 219 - 264
Target Start/End: Original strand, 40390353 - 40390398
Alignment:
219 ccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||| ||||||| |||||||||||||||||||||    
40390353 ccgaaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40390398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 204 - 264
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| |||||| ||||||||| |||| ||||||| |||||||| ||||||||||||    
14266431 tggtgggac-ccttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt 14266372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 31672733 - 31672800
Alignment:
149 tcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactc 214  Q
    ||||||||||||||| || |||||||  || || |||| ||||||| |||||||||||||||||||||    
31672733 tcctggaaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactc 31672800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 198 - 242
Target Start/End: Complemental strand, 46170033 - 46169989
Alignment:
198 accaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||| |||| |||||||| ||||||||||||||||||||    
46170033 accaaatggtaggaccccttcccggaccctgcatatgtgggagct 46169989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 216 - 264
Target Start/End: Original strand, 47624208 - 47624256
Alignment:
216 ttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||| ||||||| |||| ||||||| |||||||||||||||||||||    
47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 47624256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 209 - 264
Target Start/End: Complemental strand, 10484671 - 10484616
Alignment:
209 ggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||| | ||||||| |||| ||||||| |||||||||||||||||||||    
10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10484616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 43956629 - 43956552
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| |||||||||||||| |  ||||||||| |||  |||||||  | |||||||||||||| |||||||||    
43956629 ttggcgcaac-ggtaaagttgttgttacttgactgaaaagtccggggttcatgttctggaaacagcctcatgtgtaaaa 43956552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 203
Target Start/End: Complemental strand, 1121382 - 1121286
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgta--aaacagggtaagactgcgtaccatacaccaaa 203  Q
    |||| ||||||||  ||| |||||| |||||| ||| || ||||||||||| | |||||||||  ||| | ||| ||||||||||| ||||||||||    
1121382 taaatttgttgtccggtggctgaaaggtcacgtgtttaagtcctggaaacaacttcttgtgtaagaaataaggtgagactgcgtacaatacaccaaa 1121286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 124; Significance: 1e-63; HSPs: 4)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 91 - 262
Target Start/End: Complemental strand, 10223 - 10052
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
10223 taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactgcgt 10124  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    || ||||||||||| ||||||| |||||||| ||||||||||||  ||||||| ||||||||||||||||||    
10123 acaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 10052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 91 - 262
Target Start/End: Complemental strand, 20551 - 20380
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
20551 taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactgcgt 20452  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    || ||||||||||| ||||||| |||||||| ||||||||||||  ||||||| ||||||||||||||||||    
20451 acaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 20380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 8905 - 8961
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaa 147  Q
    |||| |||||||||| ||| ||||||||||||||||||||||||||||| |||||||    
8905 taaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaa 8961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 19233 - 19289
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaa 147  Q
    |||| |||||||||| ||| ||||||||||||||||||||||||||||| |||||||    
19233 taaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaa 19289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 122; Significance: 2e-62; HSPs: 62)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 8170157 - 8169984
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||    
8170157 taaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaacagggtaaggctgcgt 8170058  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||||||||||||||||| |||||||| |||||||||||| ||||| |  ||||||||||||||||||||    
8170057 acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttt 8169984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 35710273 - 35710446
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||    
35710273 taaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctgcgt 35710372  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     | ||||||||||||||||||| |||||||| | | |||||||| |||||||||||||||||||||||||||||    
35710373 tcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcccttt 35710446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 118 - 264
Target Start/End: Original strand, 32703411 - 32703557
Alignment:
118 tgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactcctt 217  Q
    |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||    
32703411 tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt 32703510  T
218 cccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||    
32703511 cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 32703557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 41014279 - 41014453
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||    
41014279 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcg 41014378  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||||||||||||||| |||||| | |||| ||||||| ||||||| |||||||||||||||||||||    
41014379 tacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 41014453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 38879541 - 38879718
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |  ||||||||||||| ||||    
38879541 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgc 38879640  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
38879641 gtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38879718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 24448850 - 24449025
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||| ||||||  |||| |||||||| ||||    
24448850 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgc 24448949  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| ||||  |||||| |||||||||||||||||||||    
24448950 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcccttt 24449025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 4619281 - 4619104
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| ||||||||||||  ||||||||||||| ||||    
4619281 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgc 4619182  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||  ||||||||||| |||||||| |||| ||||||| | ||||| |||||||||||||||||||||    
4619181 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt 4619104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 91 - 264
Target Start/End: Original strand, 43334162 - 43334339
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||   ||||||||||||| |||    
43334162 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctg 43334261  T
188 cgtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| |||||||  |||||||||||| |||||||| |||||||  ||| ||||||| |||||||||||||||||||||    
43334262 cgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcccttt 43334339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 91 - 265
Target Start/End: Original strand, 1565391 - 1565567
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa---cagggtaagactg 187  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||| ||||||| ||||||   ||   |||| |||    
1565391 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaaggctg 1565490  T
188 cgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||| || |||||||||| ||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||    
1565491 cgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagct-tagtgcaccgggttgcccttta 1565567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 149 - 261
Target Start/End: Original strand, 7368416 - 7368528
Alignment:
149 tcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtg 248  Q
    ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||    
7368416 tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtg 7368515  T
249 caccgggttgccc 261  Q
    |||||||||||||    
7368516 caccgggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 22861841 - 22861669
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| ||||| |||||| ||||||||||||||||||||||||| ||||||| ||||| |||| ||| ||| ||||||||||||||| | |||||||||      
22861841 taaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaacaag-taagactgctc 22861743  T
191 accatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    || ||||| ||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||  |||||||||    
22861742 acaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgcccttt 22861669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 91 - 260
Target Start/End: Original strand, 27328712 - 27328885
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||| ||||| |||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |||||||||  ||||||||||||| ||||    
27328712 taaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgc 27328811  T
189 gtaccatacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    |||| ||||||||  ||||||||||| |||||||||||||||| |||| ||||||| || |||| ||| |||||    
27328812 gtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcc 27328885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 91 - 192
Target Start/End: Complemental strand, 37024729 - 37024628
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgt 190  Q
    |||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
37024729 taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgt 37024630  T
191 ac 192  Q
    ||    
37024629 ac 37024628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 19143111 - 19142943
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgcgtacca 194  Q
    ||||||||| ||||||| ||||||||| |||||| ||||| ||| ||||||| ||||||||||| |||||||||||||| ||||||||| ||||||||      
19143111 ttggcgcaa-tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacag 19143013  T
195 tacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||||||||||||| |||||||| ||| ||| |||| ||||| | |||||||| ||  ||||||||    
19143012 tacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactggcctgcccttt 19142943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 114 - 264
Target Start/End: Original strand, 1405170 - 1405322
Alignment:
114 ttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtaccatacaccaaatggtggga 211  Q
    ||||||||||||||||  || ||||||||||||| ||||||||||| |||||| | ||||| |  | |||||  ||||||| ||||||||||||||||||    
1405170 ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtggga 1405269  T
212 ctccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    | | |||| |||||||||||||| |||||||||||| |||||| |||||||||    
1405270 ccctttcctgaaccctgcatatgcgggagctctagtacaccggattgcccttt 1405322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 91 - 266
Target Start/End: Original strand, 22187245 - 22187424
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| ||||||||||| |||||||||||||||| ||||||||| ||||| |||| || ||||||||||||||||||||||  |||||| | |||||||||    
22187245 taactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgc 22187344  T
189 gtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||| |||||||  |||   || ||| ||||||| |||||| ||||||  |||||| ||||||| | |||||||||||||    
22187345 gtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgccctttat 22187424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 170 - 267
Target Start/End: Complemental strand, 34154908 - 34154811
Alignment:
170 taaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttata 267  Q
    |||| ||||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||||||||||||    
34154908 taaatcagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccctttata 34154811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 140 - 266
Target Start/End: Complemental strand, 13801895 - 13801765
Alignment:
140 gggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgt 235  Q
    |||||||| |||||||| |||||||||||||||||  ||||||||| |||||||| |||||||||  |||||||||| |||||||| |||| |||||||     
13801895 gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc 13801796  T
236 gggagctctagtgcaccgggttgccctttat 266  Q
    | ||||| |||||||||||||||||||||||    
13801795 gagagctttagtgcaccgggttgccctttat 13801765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 91 - 241
Target Start/End: Original strand, 2838738 - 2838890
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactg-aaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggtaagactgc 188  Q
    |||| |||||||||| |||||||||||||||||||||||| ||| |||||| | |||| ||   |||||||| |||||||||||| ||||||||| ||||    
2838738 taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaacagggtaaggctgc 2838837  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagc 241  Q
    |||| ||||||||||||||||||  ||||| || ||||||| |||| ||||||    
2838838 gtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 96 - 263
Target Start/End: Complemental strand, 12006500 - 12006329
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcac-gggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtac 192  Q
    |||||||||||| | ||||||||||||||||||||||| ||||| |||||||| | ||||||||| |||||| |||  |||| |||||||| || | |||    
12006500 ttggcgcaactgctcaagttgttgtcatgtgactgaaaggtcacggggttcaagt-ctggaaacaacctcttatgtaaaaaatagggtaaggctccatac 12006402  T
193 catacacca--aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
     ||||||||  ||||||||||| |||||||  ||||||| |||| ||||||| |||||||||| |||||||||    
12006401 aatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt 12006329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 155 - 266
Target Start/End: Complemental strand, 7097870 - 7097758
Alignment:
155 aaacagcctcttgtgtaaaa-cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccg 253  Q
    |||||||||||||||||||| |||||||||  ||||||| ||||||||||||||| ||| |||||||||||||||| |||| ||||||| |||||||||     
7097870 aaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacca 7097771  T
254 ggttgccctttat 266  Q
     | ||||||||||    
7097770 tgctgccctttat 7097758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 96 - 255
Target Start/End: Original strand, 39301089 - 39301249
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtg--taaaacagggtaagactgcgtacc 193  Q
    |||||||||| ||||||||||||||||||| ||||||| ||||||||||||| || ||| |||| |||||||||  ||||||||||||||  ||||||      
39301089 ttggcgcaac-ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtata 39301187  T
194 atacacc-aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    || |||| ||| |||||||| |||||||| ||||| | |||||||||| | ||||||||||||    
39301188 atgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg 39301249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 43574610 - 43574732
Alignment:
135 gtcacgggttcaaatcctggaaacagcctcttgtgta--aaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcata 232  Q
    |||||| |||||| |||||||||||  ||||||||||  |||||||||||| |||||||| ||| ||||||||||||||| |||||||| ||||||| ||    
43574610 gtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgta 43574709  T
233 tgtgggagctctagtgcaccggg 255  Q
    || ||||||| ||| ||||||||    
43574710 tgcgggagctttagagcaccggg 43574732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 103 - 242
Target Start/End: Original strand, 22600426 - 22600567
Alignment:
103 aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacacc 200  Q
    |||||||||||||||| ||||||||||| || || |||||||||| |||||||||||   | |||||||||  |||||||||| ||| |||| |||||||    
22600426 aactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaatacacc 22600525  T
201 aaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||||||||  |||||||| | ||||| |||| |||||||    
22600526 aaatggtgggatcccttcccggatcctgcgtatgcgggagct 22600567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 91 - 266
Target Start/End: Original strand, 30006285 - 30006462
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaa--aacagggtaagactgc 188  Q
    ||||||||||||||||| |||| |||||||||||||||||||| ||||  | ||||| ||| | ||||| |||||| | |||  ||||||||||| |||     
30006285 taacattggcgcaactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgt 30006384  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    ||||  ||||| |||||||||||| ||||||||   |||   |||| ||||||| ||||||||||||||||| |||||    
30006385 gtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgccttttat 30006462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 156 - 266
Target Start/End: Complemental strand, 16880757 - 16880645
Alignment:
156 aacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccg 253  Q
    |||||||||||||||||||  ||||||||| |||||||| ||||||||||||||| |||  ||||||| ||| ||| |||| ||||||| ||||||||||    
16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg 16880658  T
254 ggttgccctttat 266  Q
    |||| ||||||||    
16880657 ggtttccctttat 16880645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 150 - 263
Target Start/End: Original strand, 20135623 - 20135740
Alignment:
150 cctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaa--atggtgggactccttcccgaaccctgcatatgtgggagctcta 245  Q
    |||||||||||||||||||||||||  || |||||| |||||||| |||||||||  |||||||||| |||||||| |||| |||||||  ||||||  |    
20135623 cctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttca 20135722  T
246 gtgcaccgggttgccctt 263  Q
    ||||||||||||||||||    
20135723 gtgcaccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 23974741 - 23974823
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||| |||||||||| |||||||||||||||||||||||| || ||||||||||||| ||||||||||| ||||||||||||||    
23974741 taaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaa 23974823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 107 - 255
Target Start/End: Complemental strand, 209086 - 208936
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacacc-aaat 204  Q
    ||||||||||||||||||||||| ||| |||||  |||||| |||||| |||| |||||||||| ||||||||||||| |||| | | ||||||| ||||    
209086 ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaat 208987  T
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    |||||||| |||||| | ||||||  ||||   ||||| ||||||||||||    
208986 ggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg 208936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 107 - 264
Target Start/End: Complemental strand, 28516593 - 28516433
Alignment:
107 ggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccataca-ccaaa 203  Q
    |||||||||||||||| ||| |||||| ||||||||||||| || |||||||| ||||||||||  |||||||| || | |||||||| ||||| | |||    
28516593 ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaa 28516494  T
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| | |||||  |||||||  |||  |||||| ||||| ||| |||||||||||    
28516493 tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgcccttt 28516433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 29334415 - 29334531
Alignment:
151 ctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacacca-aatggtgggactccttcccgaaccctgcatatgtgggagctctagt 247  Q
    ||||||||||||||||||||||||  || |||||| |||||||| |||||||| ||||||||||| | |||||| ||||||| ||||||||| || || |    
29334415 ctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaat 29334514  T
248 gcaccgggttgcccttt 264  Q
    |||||||| ||||||||    
29334515 gcaccgggctgcccttt 29334531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 115 - 254
Target Start/End: Original strand, 1850624 - 1850764
Alignment:
115 tgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggact 213  Q
    ||||||||||||||||||| ||||||||||||| ||| ||||| | |||||||||| |||||||  ||||  ||||||| ||||| |||||||||||||     
1850624 tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggacc 1850723  T
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
     ||||| | |||||||  ||| || |||| |||||||||||    
1850724 acttcctggaccctgcggatgcggaagctttagtgcaccgg 1850764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 205 - 265
Target Start/End: Complemental strand, 30877623 - 30877563
Alignment:
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
30877623 ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttta 30877563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 16957374 - 16957449
Alignment:
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
16957374 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 16957449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 91 - 203
Target Start/End: Original strand, 31299592 - 31299705
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgt-gtaaaacagggtaagactgcg 189  Q
    |||| |||| ||||||||||||||||||||||||||||| | | |||||  |||||| |||| |||||||||||||||  |||||||| |||| ||||||    
31299592 taaccttggtgcaactggtaaagttgttgtcatgtgacttacaggtcactagttcaagtcctagaaacagcctcttgtattaaaacagtgtaaaactgcg 31299691  T
190 taccatacaccaaa 203  Q
    ||| ||||| ||||    
31299692 tacaatacatcaaa 31299705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 267
Target Start/End: Complemental strand, 5873435 - 5873319
Alignment:
152 tggaaacagcctcttgtgtaaaac-agggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgca 250  Q
    |||||||||||||||||||||||  |||||||| ||  ||||  |||||||| ||||||||||||| |||| || |||| |||| ||||||| |||||||    
5873435 tggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgca 5873336  T
251 ccgggttgccctttata 267  Q
     |||| |||||||||||    
5873335 tcgggatgccctttata 5873319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 109 - 242
Target Start/End: Complemental strand, 24323862 - 24323727
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacaccaaatgg 206  Q
    |||||||||| || ||||||||||||||||   |||||| | ||||||||| |||||||||||||  ||||||||||  ||||||  |||| |||||| |    
24323862 taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag 24323763  T
207 tgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||| |||||||  |||||| ||||| |||||||    
24323762 tgggaccccttcccagaccctgtatatgcgggagct 24323727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 109 - 242
Target Start/End: Complemental strand, 24360486 - 24360351
Alignment:
109 taaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccatacaccaaatgg 206  Q
    |||||||||| || ||||||||||||||||   |||||| | ||||||||| |||||||||||||  ||||||||||  ||||||  |||| |||||| |    
24360486 taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag 24360387  T
207 tgggactccttcccgaaccctgcatatgtgggagct 242  Q
    |||||| |||||||  |||||| ||||| |||||||    
24360386 tgggaccccttcccagaccctgtatatgcgggagct 24360351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 205 - 264
Target Start/End: Complemental strand, 16028683 - 16028624
Alignment:
205 ggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||    
16028683 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 16028624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 94 - 264
Target Start/End: Original strand, 3771305 - 3771474
Alignment:
94 cattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtacc 193  Q
    |||||||||||| | ||| |||||| ||| |||||||||| ||||| |||| || || || |||||| || |     ||||||||||||| ||| | ||     
3771305 cattggcgcaacag-taatgttgttctcacgtgactgaaaggtcacaggtttaagtcatgtaaacagtctgtgtaaaaaaacagggtaaggctgtgaaca 3771403  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||| ||||||||| |||||||| || |||  |||||||||||| |||||||||||| ||||||||    
3771404 atacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt 3771474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 116 - 212
Target Start/End: Complemental strand, 22908014 - 22907917
Alignment:
116 gttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcgtaccatacaccaaatggtgggac 212  Q
    ||||| |||||||||||| |||| |||||||| |||  ||||||||||||||||| ||||||| |||||  ||| ||| |||||||||||||||||||    
22908014 gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggac 22907917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 111 - 255
Target Start/End: Complemental strand, 34074717 - 34074573
Alignment:
111 aagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaatggtg 208  Q
    ||||||||||||  ||||||||| |||||  |||||| |||| |||||||||||||||||  ||||||  |||||  ||||| | |||||||||||||      
34074717 aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggca 34074618  T
209 ggactccttcccgaaccctgcatatgtgggagctctagtgcaccggg 255  Q
    || | ||||||| |||||||| |||| |||||  |||||||||||||    
34074617 gggccccttcccaaaccctgcgtatgggggag--ctagtgcaccggg 34074573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 131 - 220
Target Start/End: Original strand, 41425948 - 41426039
Alignment:
131 aaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtaccatacaccaaatggtgggactccttccc 220  Q
    ||||||||||||||||| | ||||||||| | | ||||||||||  ||||||||| |||| ||| ||||||||| ||||||||| |||||||    
41425948 aaatgtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttccc 41426039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 149 - 266
Target Start/End: Complemental strand, 12575779 - 12575658
Alignment:
149 tcctggaaacagcctcttgtgtaaa---acagggtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctct 244  Q
    ||||||||||||||||||| |||||   ||||| |||   ||||||| |||||||||| ||||||||| |||||| | ||||||| ||||  |||||| |    
12575779 tcctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagcttt 12575680  T
245 agtgcaccgggttgccctttat 266  Q
     |||||||||| ||||||||||    
12575679 ggtgcaccgggctgccctttat 12575658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 202 - 264
Target Start/End: Original strand, 25622533 - 25622595
Alignment:
202 aatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||| |||||||| ||||||| |||| ||||||| ||||||||||| |||||||||    
25622533 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 25622595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 11462913 - 11462958
Alignment:
217 tcccgaaccctgcatatgtgggagctctagtgcaccgggttgccct 262  Q
    |||||||| ||||||||| |||||||||||||||||||||||||||    
11462913 tcccgaactctgcatatgcgggagctctagtgcaccgggttgccct 11462958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 96 - 161
Target Start/End: Original strand, 17419879 - 17419944
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagc 161  Q
    |||||| |||||||||| ||||||| |||||||||||| || ||| |||||| |||||||||||||    
17419879 ttggcgtaactggtaaaattgttgtaatgtgactgaaaggttacgagttcaagtcctggaaacagc 17419944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 96 - 157
Target Start/End: Complemental strand, 39079935 - 39079875
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaa 157  Q
    |||||||||| |||||||||||||||||||||| |||| ||||||||||||| || ||||||    
39079935 ttggcgcaac-ggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagtcttggaaa 39079875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 22025538 - 22025586
Alignment:
126 gactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||| |||| |||||||| ||||||||||||||||||||||||||    
22025538 gactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaa 22025586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 42924977 - 42924895
Alignment:
123 tgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtaccatacaccaaa 203  Q
    ||||||||||| |||||| |||||| ||||| ||||| | ||||||||  |||||||||||||  ||||||| ||||||||||    
42924977 tgtgactgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaa 42924895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 10634315 - 10634238
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||| ||| |||||||||||| |||||||||| |||| |||||||| |||| |||||| |||| |||| ||||    
10634315 ttggcgcaac-ggtgaagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctcgtgtgcaaaa 10634238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 11657785 - 11657699
Alignment:
179 gtaagactgcgtaccatacaccaaa-tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||| |||| ||| |||||||||| ||||||||| ||||||||||||||||| | | |||| || |||| ||||||| ||||||||    
11657785 gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttt 11657699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 223 - 263
Target Start/End: Original strand, 19438760 - 19438800
Alignment:
223 accctgcatatgtgggagctctagtgcaccgggttgccctt 263  Q
    |||||||||||| ||||||||||||||||| ||||||||||    
19438760 accctgcatatgcgggagctctagtgcaccaggttgccctt 19438800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 91 - 123
Target Start/End: Original strand, 41956892 - 41956924
Alignment:
91 taacattggcgcaactggtaaagttgttgtcat 123  Q
    |||||||||||||||||||||||||||||||||    
41956892 taacattggcgcaactggtaaagttgttgtcat 41956924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 4654478 - 4654427
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcacc 252  Q
    |||||||||||  ||||| ||||||||||||||| ||||||| |||||||||    
4654478 aaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc 4654427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 171 - 254
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
171 aaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgg 254  Q
    |||||||||||||||||| ||| ||||||||||| ||||||  ||||| |  |||| |||||||  | |||| |||||||||||    
9794471 aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg 9794388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 193 - 264
Target Start/End: Complemental strand, 10943915 - 10943845
Alignment:
193 catacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||   ||||| |||||||| |||||||| ||| ||||||| |||||||||||| ||||||||    
10943915 catacaccaaataacgggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttt 10943845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 91 - 129
Target Start/End: Original strand, 19438709 - 19438747
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgact 129  Q
    |||| |||||||||||||||||||||||||||| |||||    
19438709 taaccttggcgcaactggtaaagttgttgtcatatgact 19438747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 106 - 148
Target Start/End: Complemental strand, 31362495 - 31362453
Alignment:
106 tggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaa 148  Q
    |||||||||||||||||||||| || || ||||||||||||||    
31362495 tggtaaagttgttgtcatgtgattggaaggtcacgggttcaaa 31362453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 32354212 - 32354262
Alignment:
214 ccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||||||| ||||||  |||| ||||||| |||||||||||||||||||||    
32354212 ccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 32354262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 201 - 261
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
201 aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccc 261  Q
    |||||||||||| |||| ||| ||||||| |||| ||||| | |||||||||| |||||||    
21784395 aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc 21784335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 204 - 260
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
204 tggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcc 260  Q
    ||||||||| |||||||  ||||| | |||| ||||||| |||||||||||||||||    
39801591 tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc 39801647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 96 - 265
Target Start/End: Original strand, 11097 - 11265
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccat 195  Q
    ||||||||||||||||||||||| | |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||  ||||| |||| ||| ||    
11097 ttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaagtaaggctgcttacaat 11195  T
196 acaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttta 265  Q
    ||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||| ||||||||||||    
11196 acaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttta 11265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 13198 - 13024
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt-aaaacagggtaagactgcg 189  Q
    |||| |||||||||| ||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||| || |||||| |||||| |||||    
13198 taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggtaaggctgcg 13099  T
190 taccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||| ||||||| ||||||||||| |||||||  ||||||| |||| ||| ||| |||||||||||||||||||||    
13098 tacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttt 13024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 96; Significance: 7e-47; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 46796 - 46966
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggtaagactgcgtacc 193  Q
    ||||||||| ||||||||||||||||||||||||  || ||||||||||||| | ||||||||| |||||||||||||| |  |||||||  |||||||     
46796 ttggcgcaattggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtaca 46895  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| |||||||| ||||||| |||| ||||||| |||||||||||||||||||||    
46896 atacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 46966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 24942 - 24772
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgc 188  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| ||     |||||||||||||||||||  ||||||||| ||||    
24942 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggtaaggctgc 24848  T
189 gtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    |||| | ||||||||||||||||| |||||||||||||||| |||| ||||||| ||||||| | |||||||||||    
24847 gtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcccttt 24772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 43679 - 43793
Alignment:
151 ctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactcc-ttcccgaaccctgcatatgtgggagctctagtgc 249  Q
    ||||||||||| |||||||||||||| |||||| |||||||| ||||||||||||||||||| || ||| || |||||||||||| ||||||||||||||    
43679 ctggaaacagcgtcttgtgtaaaacaaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgc 43778  T
250 accgggttgcccttt 264  Q
    || | ||||||||||    
43779 actgagttgcccttt 43793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 47041 - 46995
Alignment:
108 gtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctgg 154  Q
    ||||||||||||||| |||||||||| |||||| |||||| ||||||    
47041 gtaaagttgttgtcaggtgactgaaaggtcacgagttcaagtcctgg 46995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 94; Significance: 1e-45; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 91 - 266
Target Start/End: Original strand, 58937 - 59116
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgc 188  Q
    |||| |||| |||||||||||| || ||||||||||||||||| ||||||||||||| |||||||||||||||||||| |  ||||||||||||||||||    
58937 taaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgc 59036  T
189 gtaccatacacc--aaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||| |||||||  |||||||||||| |||||||  || |||| |||| ||||||| ||||||| |||||||||||||||    
59037 gtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctttat 59116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 93; Significance: 4e-45; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 152 - 264
Target Start/End: Complemental strand, 48746 - 48634
Alignment:
152 tggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcac 251  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||    
48746 tggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac 48647  T
252 cgggttgcccttt 264  Q
    |||||||||||||    
48646 cgggttgcccttt 48634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 91; Significance: 7e-44; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 100 - 266
Target Start/End: Complemental strand, 1751 - 1585
Alignment:
100 cgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaagactgcgtaccatacac 199  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||||| ||||| ||||| |||||||||||||||||| |||| |||| ||| ||||||    
1751 cgcaattggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaacaggataaggctgcatacaatacac 1652  T
200 caaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgccctttat 266  Q
    |||||| |||||| |||||||| |||| || |||| ||||||| ||||||||| ||||||| |||||    
1651 caaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgccttttat 1585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 10775 - 10945
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaagactgcgtacc 193  Q
    |||| |||||||||||||||||||||||||||||| || |||||||||||||   ||| ||||| ||||||||||||||  ||||||| | |||||| |     
10775 ttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtcca 10874  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||||||||||||||| |||||||| ||||||| |||| ||||||| |||||||| ||||||| ||||    
10875 atacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctcttt 10945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 91 - 212
Target Start/End: Complemental strand, 226581 - 226457
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagactg 187  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| ||||||||||||||| |   ||||||||||||| |||    
226581 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctg 226482  T
188 cgtaccatacaccaaatggtgggac 212  Q
    | ||| ||||| |||||||||||||    
226481 catacaatacatcaaatggtgggac 226457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 90 - 212
Target Start/End: Complemental strand, 35195 - 35069
Alignment:
90 ataacattggcgcaactggtaaagttg-ttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt---aaaacagggtaagac 185  Q
    ||||| |||| |||||||||||||||  |||||||||||||| || ||||||||||||| ||||| |||||| |||||||||   ||||||||||||| |    
35195 ataactttggtgcaactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggc 35096  T
186 tgcgtaccatacaccaaatggtgggac 212  Q
    ||||||| |||||||||||||||||||    
35095 tgcgtacaatacaccaaatggtgggac 35069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 64; Significance: 9e-28; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 177 - 264
Target Start/End: Complemental strand, 24220 - 24133
Alignment:
177 gggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
    ||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||| |||||||||    
24220 gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttt 24133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 96 - 264
Target Start/End: Complemental strand, 73031 - 72867
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaaca-gcctcttgtgtaaaa--cagggtaagactgcgtac 192  Q
    |||||||||||||||||||||||||||||||       |||||||||||||| |||| |||||| | |||||||||||||  || |||||| |||| |||    
73031 ttggcgcaactggtaaagttgttgtcatgtg-------tgtcacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcctac 72939  T
193 catacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctagtgcaccgggttgcccttt 264  Q
     |||||||||||||| | || |||||||| | ||||| |||| ||||||| ||||||||| |||||||||||    
72938 aatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgcccttt 72867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 99 - 227
Target Start/End: Original strand, 4125 - 4258
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaa--acagggtaagactgcgtaccata 196  Q
    |||||||| ||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||||||||  ||||| ||||  ||||||| |||    
4125 gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaata 4224  T
197 cacc---aaatggtgggactccttcccgaaccct 227  Q
    ||||   || ||||||||| |||||||| |||||    
4225 caccaataattggtgggaccccttcccggaccct 4258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 91 - 159
Target Start/End: Original strand, 83835 - 83903
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaaca 159  Q
    |||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||| || ||||||||    
83835 taaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaaca 83903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 149 - 265
Target Start/End: Original strand, 3562 - 3680
Alignment:
149 tcctggaaacagcctcttgtgtaaaacag--ggtaagactgcgtaccatacaccaaatggtgggactccttcccgaaccctgcatatgtgggagctctag 246  Q
    ||||||||| |||||||||||||||| |   |||||| |||||||  ||||||| |||| |||||| |||||||||||||||| |||| || |||| |||    
3562 tcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttag 3661  T
247 tgcaccgggttgcccttta 265  Q
    ||||||| ||| |||||||    
3662 tgcaccgagtttcccttta 3680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 43097 - 43172
Alignment:
99 gcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    ||||||||||||||||| ||||||||||| ||||| |||||| |||||  |||| |||||||||||||||||||||    
43097 gcgcaactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaa 43172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 8865 - 8934
Alignment:
105 ctggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa 174  Q
    |||||||||||||||||||||||||| || ||||| ||||||| ||||||||||| | ||||||||||||    
8865 ctggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaa 8934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 91 - 162
Target Start/End: Original strand, 24624 - 24695
Alignment:
91 taacattggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcc 162  Q
    |||| ||||| ||| || |||||||||||||| ||||||| || ||||||||||||| ||||||||||||||    
24624 taaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacagcc 24695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 242
Target Start/End: Original strand, 23569 - 23712
Alignment:
96 ttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaaatcctggaaacagcctcttgtgt--aaaacagggtaagactgcgtacc 193  Q
    |||||||||| |||||||||||    |||||||||||| |  |||||||||| || || ||||| ||||||||||  |||||||||| || ||||||||     
23569 ttggcgcaac-ggtaaagttgt----atgtgactgaaagggtacgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtaca 23663  T
194 atacaccaaatggtgggactccttcccgaaccctgcatatgtgggagct 242  Q
    ||  | ||||||||||||| |||||||  ||| ||  ||||||||||||    
23664 atgtagcaaatggtgggaccccttcccagaccttgagtatgtgggagct 23712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University