View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_40 (Length: 379)
Name: NF15302_high_40
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_40 |
 |  |
|
| [»] scaffold0836 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0836 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0836
Description:
Target: scaffold0836; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 25 - 372
Target Start/End: Complemental strand, 2218 - 1873
Alignment:
| Q |
25 |
agcaatcaggtcacactttaccttgtagaagtcgttatcgatatccatgatatggaagcccccttgatagttttcacaacttttctagccgttccctcaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2218 |
agcaatcaggtcacactttaccttgtagaagctgttatcgatatccatgatatcgaagcccccttgatagtttccacaacttttttagccgttccctcaa |
2119 |
T |
 |
| Q |
125 |
taca-tgataaccaacagttttgtccaagagcttgatcaccagggaccctgcccacgggttaaatagctccttgaattaactctcatctagtgtgactac |
223 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2118 |
tacaatgttaaccaacagttttgtccaagagcttgatcaccagggaccctgcccacgggttaaatagctccttgaattaacactcatctagtgtgactac |
2019 |
T |
 |
| Q |
224 |
tggcagaagcaggtttcctccttgatgtgcaatttttaccagaccttgcgcaaccaggtccagtttttcttttgctggcgcaagttgttgtccttcagca |
323 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
2018 |
cggcagaagttggtttactccttgatgtgcaatttttaccagaccttgcgcaacctggtccactttttcttttgctggcgcaagttgttgtcctt---ca |
1922 |
T |
 |
| Q |
324 |
gtaagcatatctcgaaaggatatttttcttgcgtttgttttgttatctg |
372 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1921 |
gtaagcatatctcgaaaggattattttcttgcgtttgtttcgttatctg |
1873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University