View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_44 (Length: 366)
Name: NF15302_high_44
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 39 - 346
Target Start/End: Original strand, 24544387 - 24544694
Alignment:
| Q |
39 |
ttgggctatttttcatttgagagggaatattcttcttatttagaccacagatttggacacttcnnnnnnngattacatttggaaacttctttttgataca |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24544387 |
ttgggctatttttcatttgagagggaatattcttcttatttagaccacagatttggacacttctttttttgattacatttggaaacttctttttgataca |
24544486 |
T |
 |
| Q |
139 |
cacaaaagaaattaaatattactattttttagtgtatatccaaataatgtgcttagctctttgtgtttacacaagaaaaaaccttctttgagaggtttat |
238 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24544487 |
cactaaagaaattaaatattactattttttagtgtatatccaaataatgtgcttagctctttgtgtttacacaagaaaaaaccttctttgagaggtttat |
24544586 |
T |
 |
| Q |
239 |
attaaatgcacttttaattgtatacacgttcttgtctttttcaagcgtcgtgaacagatgattttgccactacaaataattacgtgaatcatatggaaca |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24544587 |
attaaatgcacttttaattgtatacacgttcttgtctttttcaagcgtcgtgaacagatgattttgccactacaaataattacgtgaatcatatggaaga |
24544686 |
T |
 |
| Q |
339 |
atccaata |
346 |
Q |
| |
|
|| ||||| |
|
|
| T |
24544687 |
attcaata |
24544694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University