View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_47 (Length: 361)
Name: NF15302_high_47
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 42331888 - 42331698
Alignment:
| Q |
16 |
tgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagttttaagagcatgaatatgattcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331888 |
tgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagttttaagagcatgaatatgattcc |
42331789 |
T |
|
| Q |
116 |
tcacagctttatccacacgtccgaagctttcaagatatctaaatggaattggtaac--nnnnnnnctttctctcttctagttcgacaatac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42331788 |
ccacagctttatccacacgtccgaagctttcaagatctctaaatggaattggtaactttttttttctttctctcttctagttcgacaatac |
42331698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 307 - 349
Target Start/End: Complemental strand, 42331596 - 42331554
Alignment:
| Q |
307 |
acttcccaacacgaaggcacatatcattctcgagggattccct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331596 |
acttcccaacacgaaggcacatatcattctcgagggattccct |
42331554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University