View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_60 (Length: 290)
Name: NF15302_high_60
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 31 - 273
Target Start/End: Complemental strand, 29709286 - 29709044
Alignment:
| Q |
31 |
ctaaagattttcttcaaatatatatttttaaacgtctagttaacttttttgctttaggcctcttaatttgttgggccagctctgaataagcaacaccgta |
130 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29709286 |
ctaaatattttcttcaaatatatatttttaaacgtctcgttaacttttttgctttaggcctcttaatttgttgggccagctctgaataagcaacaccatg |
29709187 |
T |
|
| Q |
131 |
ttcaccaaatcattaaatcagttctcatgatcaaattatgacccttgatgacaatcaaaatgtgctccatgaatcatagtagattactagtagctgaatc |
230 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
29709186 |
ttcaccaaaacattaaatcagttctcatgatcaaattatgacccttgatgacaatcaaaatgtgatccgtgaatcatagtggattactagtagctgaatc |
29709087 |
T |
|
| Q |
231 |
gacgattcggtctcataactcaacgtttcttgacctcacctat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29709086 |
gacgattcggtctcataactcaacgtttcttgacctcacctat |
29709044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 107
Target Start/End: Original strand, 1214431 - 1214468
Alignment:
| Q |
70 |
ttaacttttttgctttaggcctcttaatttgttgggcc |
107 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1214431 |
ttaaattttttgctttaggcatcttaatttgttgggcc |
1214468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University