View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_63 (Length: 283)
Name: NF15302_high_63
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 21624621 - 21624402
Alignment:
| Q |
15 |
attattctttttgtttatctaatttgattaagtataaaaggtcacaattaaacagtgtgacagannnnnnnaataagcccataaatttattaaagaaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
21624621 |
attattctttttgtttatctaatttgattaagtataaaaggtcacaattaaacagtgtgacagatttttttaataagcccat----ttattaaagaaata |
21624526 |
T |
 |
| Q |
115 |
gaagaatcccaccaccaaaagtgtcaagatgaaaatttgtttcacaacatcgttgatgagattaaaatagttcaattgtgaatgaaggaattgatggggt |
214 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| | |
|
|
| T |
21624525 |
gaagactcccacaaccaaaagtgtcaagatgaaaatttgtttcacaacatcgttgatgagatt-aattagttcaattgtgaatgaaggaattgatgggct |
21624427 |
T |
 |
| Q |
215 |
atcaagaagctcatcaaggaacacc |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21624426 |
atcaagaagctcatcaaggaacacc |
21624402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University