View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_75 (Length: 253)
Name: NF15302_high_75
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 45374650 - 45374869
Alignment:
| Q |
9 |
atagcttaggcctctccaagttaatataactgtacaatggtgcaataagggtgatgatta------ttaatagtagtaggataaaaagtgaaagatatta |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45374650 |
atagcttaggcctcaccaagttaatataactgtacaatggtgtaatacgggtgatgattattattattaatagtagtaggataaaaagtgaaagatatta |
45374749 |
T |
 |
| Q |
103 |
atgtatagtaccaggggagcttctgatcttgcacgtatggaaaccctggcttttttgaaaggaagtaggtcttgtgtgggttcttctaacttggatgagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374750 |
atgtatagtaccaggggagcttctgatcttgcacgtatggaaaccctggcttttttgaaaggaattaggtcttgtgtgggttcttctaacttggatgagt |
45374849 |
T |
 |
| Q |
203 |
gtgagaaatcttctgcagga |
222 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
45374850 |
gtgaggaatcttctgcagga |
45374869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University