View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_80 (Length: 247)
Name: NF15302_high_80
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_80 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 26564777 - 26565006
Alignment:
| Q |
18 |
atagttggattaacgaagaatgcttcttgtgaattgggaaaatatggtataagggttaattgcatttctccatttggtgttgcaacatctatgcttgtga |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26564777 |
atagttggattaacaaagaatgcttcttgtgaattgggaaaatatggtataagggttaattgcatttctccatttggtgttgcaacatctatgcttgtga |
26564876 |
T |
 |
| Q |
118 |
atgcttggagaaatggagaagatgaagttgatgatggaatcaattttggattgcctttaattgaagaggttgagaaaatggaggaatttgttagagggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26564877 |
atgcttggagaaatggagaagatgaagttgatgaaggaatcaattttggattgcctttaattgaagaggttgagaaaatggaggaatttgttagagggat |
26564976 |
T |
 |
| Q |
218 |
tggtaatttgagaggaacaactttaaagac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26564977 |
tggtaatttgagaggaacaactttaaagac |
26565006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University