View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_81 (Length: 247)
Name: NF15302_high_81
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_81 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 6897800 - 6898000
Alignment:
| Q |
24 |
caaatgggaatttggtactatacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttctttt |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6897800 |
caaatgggaatttggtactgtacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttctttt |
6897899 |
T |
|
| Q |
124 |
ctagtactc--tgtgtactgtattgtctgctatatgacttatacgtgtaattgagttcagcagcttgaacat---atgaagggatgtttccttaaaccat |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6897900 |
ctagtactctttgtgtactgtattgtctgc--tatgacttat--gtgtaattgagttcagcagcttgaacatatgatgaagggatgtttccttaaaccat |
6897995 |
T |
|
| Q |
219 |
ataga |
223 |
Q |
| |
|
||||| |
|
|
| T |
6897996 |
ataga |
6898000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University