View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_83 (Length: 246)
Name: NF15302_high_83
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_83 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 41067002 - 41067174
Alignment:
| Q |
1 |
tttttctcttaatctgtgtgaaataagaaaatttgacagttattgttggactgatggtgtagtattttactcacttggctaatagaaactaactgctgtc |
100 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067002 |
tttttctcttaatctgcgtgaaataggaaaatttgacagttattgttggactgatggtgtagtattttactcacttggctaatagaaactaactgctgtc |
41067101 |
T |
 |
| Q |
101 |
aaatcttcaccagggtaatttctataatgagaaattaacc--gagtgagaggtgctgttggaactgtaagtat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41067102 |
aaatcttcaccagggtaatttctataattagaaattaaccgagagtgagaggtgctgttggaactgtaagtat |
41067174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 167 - 246
Target Start/End: Complemental strand, 41066860 - 41066781
Alignment:
| Q |
167 |
agtatttggttaatagaatcatcaagagaaacgaacacaacatctttacttaaaattttaaggggcgaactatatgagtc |
246 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41066860 |
agtatttagttaatagaatcatcaagagaaacgaacacaacatctttacttaaaactttaaggggcgaactatatgagtc |
41066781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University