View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_high_89 (Length: 240)
Name: NF15302_high_89
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_high_89 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 14865 - 14670
Alignment:
| Q |
32 |
aggacataggataatctatattagttttatatttgaaaatcaaataactactaaaccaattcaaaggtgaccatgtgatctctaatattggatctagatg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14865 |
aggacataggataatctatattagttttatatttgaagatcaaataactactaaaccaattcaaaggtgaccatgtgatctctaatattggatctagatg |
14766 |
T |
|
| Q |
132 |
a-ttgttttga-tattttactatattaatcattcatatgataatttggtcagatggctgtgctttgtctgttaatggaggcaaccatgcagatgat |
225 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14765 |
atttgttttgattattttactatattaatcattcatatgataatttggtcagatggttgtgctttgtctgttaatggagccaaccatgcagatgat |
14670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University