View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_low_102 (Length: 240)

Name: NF15302_low_102
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_low_102
NF15302_low_102
[»] scaffold0140 (1 HSPs)
scaffold0140 (32-225)||(14670-14865)


Alignment Details
Target: scaffold0140 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 14865 - 14670
Alignment:
32 aggacataggataatctatattagttttatatttgaaaatcaaataactactaaaccaattcaaaggtgaccatgtgatctctaatattggatctagatg 131  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14865 aggacataggataatctatattagttttatatttgaagatcaaataactactaaaccaattcaaaggtgaccatgtgatctctaatattggatctagatg 14766  T
132 a-ttgttttga-tattttactatattaatcattcatatgataatttggtcagatggctgtgctttgtctgttaatggaggcaaccatgcagatgat 225  Q
    | ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||    
14765 atttgttttgattattttactatattaatcattcatatgataatttggtcagatggttgtgctttgtctgttaatggagccaaccatgcagatgat 14670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University