View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_low_104 (Length: 237)

Name: NF15302_low_104
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_low_104
NF15302_low_104
[»] chr4 (1 HSPs)
chr4 (1-222)||(342960-343168)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 343168 - 342960
Alignment:
1 taaaggctaaaatgatatagacatttttgttaatgatgaacttgaagcaatattggggaagaaatgattgacatcaccattgatgcaacaaaagttccta 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||    
343168 taaaggctaaaatgatatagatatttttgttaatgatgaacttgaagcaatattggggaaga---------catcaccattgatgcaacaaaagttccta 343078  T
101 attaatgatgaaatagtacttttcgtggatcaagttgaccactacaataacttgaaggaactgcagatatttcttgtcttcctttccactcttcaccagg 200  Q
    ||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
343077 at----gatgaaatagtacttttcgtggatcaagttgaccactacaataacttgaaggaactgcagatatttcttgtcttcctttccactcttcaccagg 342982  T
201 tttgagagtaattgctttttct 222  Q
    ||||||||||||||||||||||    
342981 tttgagagtaattgctttttct 342960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University