View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_106 (Length: 234)
Name: NF15302_low_106
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 6608505 - 6608723
Alignment:
| Q |
1 |
gttttgttcatcatcaaacttcaccgtctcagattgggataagaactgtggatgtggataacacttgtaacttctccaccacttcaaatctatccatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6608505 |
gttttgttcatcatcaaacttcaccgtctcagattgggataagaaccgtggatgtggataacacttgtaacttctccaccacttcaaatctatgcatctc |
6608604 |
T |
 |
| Q |
101 |
catagttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgta-----tttgctgacaaaattttat |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6608605 |
catatttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgtatttgctttgctgacaaaattttat |
6608704 |
T |
 |
| Q |
196 |
ttctatttagttgttgttt |
214 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6608705 |
ttctatttagttgttgttt |
6608723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University