View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_107 (Length: 233)
Name: NF15302_low_107
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 127 - 225
Target Start/End: Complemental strand, 37592146 - 37592048
Alignment:
| Q |
127 |
ccagactggatattcatctccagctcaagatgctatcaggagggatcttaatctatctttggaagaggtaagccagtaatcattctctctcatattctt |
225 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37592146 |
ccagactgggtattcatctccagctcaagatgctatcaggagggatcttaatctgtctttggaagaggtaagccagtaatcattctctctcatattctt |
37592048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 37592255 - 37592200
Alignment:
| Q |
18 |
gttcttatgaatttggtgcttgtgtaagtcttcacttctttctctgtaaatcagca |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37592255 |
gttcttatgaatttggtgcttgtgtaagtcttcacttctttctctgtaaatcagca |
37592200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 37462214 - 37462288
Alignment:
| Q |
132 |
ctggatattcatctccagctcaagatgctatcaggagggatcttaatctatctttggaagaggtaagccagtaat |
206 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| |||| |||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
37462214 |
ctggatattcatctccaactcaagaagctattaggaaggatcttagtctgtctttggcagaggtaagccagtaat |
37462288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 37462034 - 37462085
Alignment:
| Q |
18 |
gttcttatgaatttggtgcttgtgtaagtcttcacttctttctctgtaaatcagca |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
37462034 |
gttcttatgaatttggtgcttgtgtaagtctttacttct----ctgtaaatcagca |
37462085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University