View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_113 (Length: 218)
Name: NF15302_low_113
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_113 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 36115799 - 36116013
Alignment:
| Q |
1 |
gtttagcttttgcaacattttttattgaaaggttataatttctgcaaggttaattat---gcttctcattccnnnnnnnnnnnnnnnnnnnnnnaaataa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
36115799 |
gtttagcttttgcaacattttttattgaaaggttataatttctgcaaggttaattattatgcttctcattccttttttcttttatttt------aaataa |
36115892 |
T |
|
| Q |
98 |
acggtgttgttgggctgatataataaaaacacatatagtaaaattgatttgacttatatgtataacgataacataaaacttttttatccatgcatacaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36115893 |
acggtgttgttgggctgatataataaaaaaacatatagtaaaattgatttgacttatatgtataacgataacataaaacttttttatccatgcatacaat |
36115992 |
T |
|
| Q |
198 |
caaatcattttattatgctac |
218 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36115993 |
caaatcattttattatactac |
36116013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University