View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_115 (Length: 215)
Name: NF15302_low_115
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_115 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 12 - 122
Target Start/End: Complemental strand, 31638193 - 31638083
Alignment:
| Q |
12 |
atcatcacttgtctttttaagatgcggataatattcattttctgtactttcttcatctgcatctacatttattaaagttcagaattctataagtttttat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31638193 |
atcatcacttgtctttttaagatgcggataatattcattttctatactttcttcatctgcatctacatttattaaagttcagaattccataagtttttat |
31638094 |
T |
 |
| Q |
112 |
atcttgttaac |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
31638093 |
atcttgttaac |
31638083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 38 - 118
Target Start/End: Original strand, 31671682 - 31671760
Alignment:
| Q |
38 |
gataatattcattttctgtactttcttcatctgcatctacatttattaaagttcagaattctataagtttttatatcttgt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||| | |||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31671682 |
gataatattcattttctaaactttcttcatccgtatctacatttgttaaagttcagaa--ctataagtttttatatcttgt |
31671760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University