View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_122 (Length: 202)
Name: NF15302_low_122
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_122 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 89 - 175
Target Start/End: Original strand, 8049954 - 8050041
Alignment:
| Q |
89 |
aaatattttatacgaatc-tcctttatttaatttgtaaatgacataaataacacataagaaatagggcacccagtagattaagtttta |
175 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8049954 |
aaatattttataagaatcctcctttatttaatttgtaaatgacataaataacacataagaaatagggcacccaggagattaagtttta |
8050041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 8049862 - 8049920
Alignment:
| Q |
11 |
gtgagatgaaccacaacattattattgctactcaaagtcgttccagtaaaattgaaggt |
69 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8049862 |
gtgagatcaaccacaacattattattgctactcaaagtcgttccagtaaaattgaaggt |
8049920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 94 - 158
Target Start/End: Original strand, 8020469 - 8020534
Alignment:
| Q |
94 |
ttttatacgaatc-tcctttatttaatttgtaaatgacataaataacacataagaaatagggcacc |
158 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8020469 |
ttttataagaatcatcctttatttaatttgtaaatgacataaataacacataagatatagggcacc |
8020534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University