View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_41 (Length: 410)
Name: NF15302_low_41
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 245 - 308
Target Start/End: Complemental strand, 12574467 - 12574404
Alignment:
| Q |
245 |
aacaaagttaagcatatctagcaagattcgagatggaatatcaacaatttaaatctctatacat |
308 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12574467 |
aacaaatttaagcatatctagcaagattcgagatggaaaatgaacaatttaaatctctatacat |
12574404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 245 - 305
Target Start/End: Complemental strand, 501044 - 500984
Alignment:
| Q |
245 |
aacaaagttaagcatatctagcaagattcgagatggaatatcaacaatttaaatctctata |
305 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
501044 |
aacaaagttaagcatatctagcaatattcgagatggaaaatcaacgatttaaatctctata |
500984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 500264 - 500300
Alignment:
| Q |
19 |
tagggtttggtgcttgttcaaaaaacaatagggtttg |
55 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
500264 |
tagggtttggtgcttgtttaaaaaagaatagggtttg |
500300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University