View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_67 (Length: 311)
Name: NF15302_low_67
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 85 - 293
Target Start/End: Original strand, 8592195 - 8592403
Alignment:
| Q |
85 |
gaacagaaatactaaattcaatttgaggaaactccgagagatttgtctactggtnnnnnnncaagtcttaaattttagagatcttaggtttcaacttctc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8592195 |
gaacagaaatactaaattcaatttgaggaaactccgagagatctgtctagtggtaaaaagacaagtcttaaattttagagatcttaggtttcaacttctc |
8592294 |
T |
|
| Q |
185 |
nnnnnnnnnngaagtgagataaatataaatacatttgtaatattctttcagctgttttggactggacaccatcttttcaccctaaattttatgtagccaa |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
8592295 |
ttctttttttgaagtgagataaatataaatacatttgtaatattctttcagctgttttggactggacaccatcctttcatcctaaattttatgtagccaa |
8592394 |
T |
|
| Q |
285 |
aagaatact |
293 |
Q |
| |
|
| ||||||| |
|
|
| T |
8592395 |
aggaatact |
8592403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 8592135 - 8592176
Alignment:
| Q |
20 |
aaataccggggaaacttgacattgcgctaacaacgtattgta |
61 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8592135 |
aaataccagggaaacttgacattgcgctaacaacgtattgta |
8592176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University