View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_77 (Length: 269)
Name: NF15302_low_77
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 110 - 257
Target Start/End: Original strand, 9279022 - 9279171
Alignment:
| Q |
110 |
cctaatcaactgttcatgataccttttgaattgtttcattcatgaaggtcggttaattattaaaacttgtctttgcaaaattttgtggacttcattgagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9279022 |
cctaatcaactgttcatgataccttttgaattgtttcattcatgaaggtcggttaattattaaaacttgtctttgcaaaattttgtggacttcattgagc |
9279121 |
T |
|
| Q |
210 |
tatagaattcaagatatggc--atcatagatgcaatattcgtgagatatt |
257 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9279122 |
tatagaattcaagatatggcaaatcatagatgcaatattcgtgagatatt |
9279171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 9278891 - 9278984
Alignment:
| Q |
17 |
caattaactactcatgttttaattggaaagttggaagttaaactctattcatgttacatatgttgcaaagtgaacctcactaaatggatttttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278891 |
caattaactactcatgttttaattggaaagttggaagttaaactctattcatgttacatatgttgcaaagtgaacctcactaaatggatttttc |
9278984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University