View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_80 (Length: 267)
Name: NF15302_low_80
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 37088400 - 37088640
Alignment:
| Q |
13 |
aatattctgtcttgctttggtcacttgtacataagtgtgtcaattttggtctagttagcaatccctgtcagtcttttgaattgtattgtatagtattctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37088400 |
aatattctgtcttgctttggtcacttgtgcataagtgtgtcaattttggtctagttagcaatccctgtcagtcttttgaattgtattgtatagtattctt |
37088499 |
T |
 |
| Q |
113 |
ttggtataatggagaatcatatctgattttttctgactcttctatggcatctagaattgtatcttgcaactatttatgtg----attcattcttctcaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37088500 |
ttggtataatggagaatcatatctgattttttctgactcttctatggcatctagaattgtatcttgcaactatttatgtgattaattcattcttctcaag |
37088599 |
T |
 |
| Q |
209 |
ttagaacctagcttaagaccatagcacttgctggcatatcc |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37088600 |
ttagcacctagcttaagaccatagcacttgctggcatatcc |
37088640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University