View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15302_low_92 (Length: 247)

Name: NF15302_low_92
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15302_low_92
NF15302_low_92
[»] chr7 (1 HSPs)
chr7 (18-247)||(26564777-26565006)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 26564777 - 26565006
Alignment:
18 atagttggattaacgaagaatgcttcttgtgaattgggaaaatatggtataagggttaattgcatttctccatttggtgttgcaacatctatgcttgtga 117  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26564777 atagttggattaacaaagaatgcttcttgtgaattgggaaaatatggtataagggttaattgcatttctccatttggtgttgcaacatctatgcttgtga 26564876  T
118 atgcttggagaaatggagaagatgaagttgatgatggaatcaattttggattgcctttaattgaagaggttgagaaaatggaggaatttgttagagggat 217  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26564877 atgcttggagaaatggagaagatgaagttgatgaaggaatcaattttggattgcctttaattgaagaggttgagaaaatggaggaatttgttagagggat 26564976  T
218 tggtaatttgagaggaacaactttaaagac 247  Q
    ||||||||||||||||||||||||||||||    
26564977 tggtaatttgagaggaacaactttaaagac 26565006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University