View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_98 (Length: 243)
Name: NF15302_low_98
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 45969666 - 45969456
Alignment:
| Q |
15 |
cataggttaaggatcattcgtaagcctgtttgcacttccaacttttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969666 |
cataggttaaggatcattcgtaagcctgtttgcacttccaacttttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatcc |
45969567 |
T |
|
| Q |
115 |
accacaatcctatcaaggaaccaaccatagnnnnnnnnntcatcttatgaagtcaatgatcaacatagattatggaaatgacttctctgttacataatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969566 |
accacaatcctatcaaggaaccaaccatagaaaaaaaaatcatcttatgaagtcaatgatcaacatagattatggaaatgacttctctgttacataatta |
45969467 |
T |
|
| Q |
215 |
ttactccctct |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
45969466 |
ttactccctct |
45969456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 130
Target Start/End: Original strand, 37653864 - 37653958
Alignment:
| Q |
36 |
aagcctgtttgcacttccaacttttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatccaccacaatcctatcaa |
130 |
Q |
| |
|
||||||||||| || || | | |||||||||| ||||||||||| |||| ||||||||||| | | || ||||||||||||||||||||||| |
|
|
| T |
37653864 |
aagcctgtttgaacatcaaccctttcttgcaaactgtagtcaccggtgatcttcccataagcccgtaataggatgatccaccacaatcctatcaa |
37653958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University