View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15302_low_99 (Length: 242)
Name: NF15302_low_99
Description: NF15302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15302_low_99 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 61271 - 61047
Alignment:
| Q |
1 |
ttttggcatcttctacaaccttctcccgatcaaaacctttctgggagaaggtcatattatttctagctttccgaactacctaaacatttgagaaccaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
61271 |
ttttggcatcttctacaaccttctcccgatcgaaacctttttgggagaaggtcatattatttctagctttccaaactacctaaacatttgagaaccaaat |
61172 |
T |
 |
| Q |
101 |
catgtgtagtttt-cgccaacctttctaccacagctcaaaaggcttttaaactgagtttggtgctccaggtcccatgttgcagggcagccaaaaccccta |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
61171 |
catgtgtagtttttcgccaacctttctaccacagctcaaaaggcttttaaactgagtttggtgctccaggtcccatgctgcagggcagccaaaaccccta |
61072 |
T |
 |
| Q |
200 |
tccaattcaaagacgcagaccatag |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
61071 |
tccaattcaaagacgcagaccatag |
61047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University