View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15303_low_9 (Length: 221)
Name: NF15303_low_9
Description: NF15303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15303_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 58 - 204
Target Start/End: Complemental strand, 23831853 - 23831707
Alignment:
| Q |
58 |
gaagtaaagctcttcaaattggttgattgtaagatctcctccacaccccgagcagtctgaggcaccgatactgttggtacctcagtattacttgagctac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23831853 |
gaagtaaagctcttcaaattggttgattgtaagatctcctccacaccccgagcagtctgaggcaccgatactgttggtacctcagtattacttgagctac |
23831754 |
T |
 |
| Q |
158 |
tgagatcgccagaaaccttgctacatggaatactaagatcttctgtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23831753 |
tgagatcgccagaaaccttgctacatggaatactaagatcttctgtg |
23831707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 59 - 128
Target Start/End: Complemental strand, 23827851 - 23827782
Alignment:
| Q |
59 |
aagtaaagctcttcaaattggttgattgtaagatctcctccacaccccgagcagtctgaggcaccgatac |
128 |
Q |
| |
|
|||| |||||||||||||||| |||||| || |||||| |||||| | || |||||| ||||||||||| |
|
|
| T |
23827851 |
aagtgaagctcttcaaattggatgattgcaacatctcccccacacgcggaagagtctgtggcaccgatac |
23827782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University