View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15304_high_3 (Length: 320)
Name: NF15304_high_3
Description: NF15304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15304_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 6 - 184
Target Start/End: Complemental strand, 38186997 - 38186819
Alignment:
| Q |
6 |
gagatgaataaaaacaattcattttgagccctaatcattgaattggtgtttgaatttcaaccttcatggccttgattctcataatcgcttctttcatttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186997 |
gagatgaataaaaacaattcattttgagcactaatcattgaattggtgtttcaatttcaaccttcatggccttgattctcataatcgcttctttcatttt |
38186898 |
T |
 |
| Q |
106 |
cctttggattatttctctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186897 |
cctttggattatttctctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
38186819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 38186733 - 38186692
Alignment:
| Q |
269 |
ggaagagaaatgtcttgcgggttattgctcaccctgatgatg |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
38186733 |
ggaagagaaatgtcttgctggttattgctcaccctgacgatg |
38186692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University