View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15304_high_5 (Length: 238)
Name: NF15304_high_5
Description: NF15304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15304_high_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 38 - 238
Target Start/End: Complemental strand, 3704410 - 3704213
Alignment:
| Q |
38 |
aattttcctgcttggcatgttcaattcaatgccctccttgtagggtatgaccttataggttatgttgatggcacaaaattatgtccaccaacctcacatg |
137 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| || || ||||| ||||||||||||||||||||||||||||| ||| ||| |||||| | ||| |
|
|
| T |
3704410 |
aatttccctgcctggcatgtccaattcaatgcactgctagtaggatatgaccttataggttatgttgatggcaccaaaccatg---cccaaccactgatg |
3704314 |
T |
|
| Q |
138 |
cacagttcaatcgatggaaaagacaggatcagctgatccttcatgccatcatctcgtctgttgaccccagcgtcatcaccatgcttggcaacgtgaaaac |
237 |
Q |
| |
|
|| | || ||| |||||| |||||||||| ||||||||||||| |||||||| |||||||| | || ||||| |||||| | ||||| || ||||| |
|
|
| T |
3704313 |
cagcctacactcgctggaaacgacaggatcaattgatccttcatgctatcatctcatctgttgatgctagtgtcataaccatgttaggcaatgttaaaac |
3704214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 38 - 201
Target Start/End: Complemental strand, 20099358 - 20099198
Alignment:
| Q |
38 |
aattttcctgcttggcatgttcaattcaatgccctccttgtagggtatgaccttataggttatgttgatggcacaaaattatgtccaccaacctcacatg |
137 |
Q |
| |
|
||||| ||||| |||||||| || |||||||| || || ||||| ||||||||||||||||||||||||||||| ||| ||| |||||| | ||| |
|
|
| T |
20099358 |
aatttccctgcctggcatgtccagttcaatgcactgctagtaggatatgaccttataggttatgttgatggcaccaaaccatg---cccaaccactgatg |
20099262 |
T |
|
| Q |
138 |
cacagttcaatcgatggaaaagacaggatcagctgatccttcatgccatcatctcgtctgttga |
201 |
Q |
| |
|
|| | || |||||||||| |||| ||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
20099261 |
cagcctacactcgatggaaacgacaagatcaattgatccttcatgctatcatctcatctgttga |
20099198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 111
Target Start/End: Original strand, 32068825 - 32068898
Alignment:
| Q |
38 |
aattttcctgcttggcatgttcaattcaatgccctccttgtagggtatgaccttataggttatgttgatggcac |
111 |
Q |
| |
|
||||| ||||| |||||||| || |||||||| || || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32068825 |
aatttccctgcctggcatgtccagttcaatgcactgctagtaggatatgaccttataggttatgttgatggcac |
32068898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 8685107 - 8685141
Alignment:
| Q |
18 |
ccctcaagctgaacagttcaaattttcctgcttgg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8685107 |
ccctcaagctgaacagttcaaattttcctgcttgg |
8685141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 115
Target Start/End: Original strand, 11918869 - 11918941
Alignment:
| Q |
43 |
tcctgcttggcatgttcaattcaatgccctccttgtagggtatgaccttataggttatgttgatggcacaaaa |
115 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||| ||||||| || |||||||| ||||| |||||| |
|
|
| T |
11918869 |
tcctgcttggcaggttctgatgaatgccctccttgtaggacatgacctcattggttatgtcgatggtacaaaa |
11918941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University