View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15306_low_5 (Length: 323)
Name: NF15306_low_5
Description: NF15306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15306_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 251 - 310
Target Start/End: Original strand, 12616110 - 12616169
Alignment:
| Q |
251 |
atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttact |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616110 |
atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttact |
12616169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University