View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15307_low_3 (Length: 350)
Name: NF15307_low_3
Description: NF15307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15307_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 37984541 - 37984236
Alignment:
| Q |
1 |
taggattgaaaattgcgagaatctgagagaaccttgaaggtgaggtcaggaggaagaggccaaacaattgaattgtgattataagcgcgtttgcgagagg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37984541 |
taggattgaaaagtgcgagaatctgagagaaccttgaaggtgaggtcaggaggaagaggccaaacaattgaattatgattataagcgcgtttgcgagagg |
37984442 |
T |
 |
| Q |
101 |
agtgtttggcagcatcaagaagtagagatcccattttgagagcgcgatcgatgagatcagtgtcagcaggcattgattgaagaagattctctaaggagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984441 |
agtgtttggcagcatcaagaagtagagatcccattttgagagcgcgatcgatgagatcagtatcagcaggcattgattgaagaagattctctaaggagag |
37984342 |
T |
 |
| Q |
201 |
atcgatggaaagagaaggacgatcggagagggagagaaattcttcgagaacgtgttcgacttccattctagggttttgtgctggacaaggtctcttcgcc |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984341 |
atcgatggaaagagaaggacaatcggagagggagagaaattcttcgagaacgtgttcgacttccattctagggttttgtgctggacaaggtctcttcgcc |
37984242 |
T |
 |
| Q |
301 |
attgat |
306 |
Q |
| |
|
|||||| |
|
|
| T |
37984241 |
attgat |
37984236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University