View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15307_low_4 (Length: 316)
Name: NF15307_low_4
Description: NF15307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15307_low_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 16 - 316
Target Start/End: Complemental strand, 31463394 - 31463094
Alignment:
| Q |
16 |
atttctttcctatgcatgctgaatcattgttagtttgatgccaataggtggagggaattcaggttcatgcaaacgagggaggggtaacacagacgcgtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31463394 |
atttctttcctatgcatgctgaatcattgttagtttgatgccaataggtggagggaattcaggttcatgcaaacgagggaggggtaacacagacgcgtgg |
31463295 |
T |
|
| Q |
116 |
tggcgtatattggttgatcttgcctgcgggatgtaatgcacttttctcccatagttttcagttgacatattaactttaagttagactaacattttttcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31463294 |
tggcgtatattggttgatcttgcctgcgggatgtaatgcacttttctcccatagttttcagttgacatattaactttaagttagactaacattttttcaa |
31463195 |
T |
|
| Q |
216 |
atgccacttcaagtagtgttagagctcataatatatcatttttctctcatttttatcctcattaacttaattgtaagatttgagtattaattaaaaataa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31463194 |
atgccacttcaagtagtgttagagctcataatatatcatatttctctcatttttatcctcattatcttaattgtaagatttgagtattaattaaaaataa |
31463095 |
T |
|
| Q |
316 |
c |
316 |
Q |
| |
|
| |
|
|
| T |
31463094 |
c |
31463094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University