View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15308_high_3 (Length: 403)
Name: NF15308_high_3
Description: NF15308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15308_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 3760899 - 3760685
Alignment:
| Q |
17 |
cacaatctgcaagttaatggggatatgtaaatttcaaaataggaacaagaatttagaatgnnnnnnnntaaagaaagagataaagcaaaagctttagtct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3760899 |
cacaatctgcaagttaatggggatatgtaaatttcaaaataggaacaagaatttagaatgaaaaaaaataaagaaagagataaagcaaaagctttagtct |
3760800 |
T |
 |
| Q |
117 |
tggatcactttctctattctcattttcccatggatgaagatctgcctttgcctttaccatcagcatcaaacccttctcactcagtttgcttgtga-ttgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3760799 |
tggatcactttctctattctcattttcccatggatgaagatctgcctttgcctttaccatcagcatcaaacccttctcactcagtttgcttgtgatttgc |
3760700 |
T |
 |
| Q |
216 |
catctcgaatctctc |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3760699 |
catctcgaatctctc |
3760685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 262 - 395
Target Start/End: Complemental strand, 3760653 - 3760520
Alignment:
| Q |
262 |
caaacctattcttgtcagtaagtttccattggaatgctttatcatgatcgagaaaattaacgtatcccaacaacactttcttttgatcataacaatcaaa |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760653 |
caaacctattcttgtcagtaagtttccattggaatgctttatcatgatcgagaaaattaacgtatcccaacaacactttcttttgatcataacaatcaaa |
3760554 |
T |
 |
| Q |
362 |
gtaccccatttactcttctttctatcatattctt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3760553 |
gtaccccatttactcttctttctatcatattctt |
3760520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University