View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15309_high_15 (Length: 239)
Name: NF15309_high_15
Description: NF15309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15309_high_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 39940870 - 39940646
Alignment:
| Q |
15 |
agaagcataatttttaagatttcttttgggatgaagaaacttcagagtcaagtaatagaaatccttttgtcatggattcattatattccagattcttatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39940870 |
agaagcataatttttaagatttcttttaggatgaagaaacttcagagtcaagtaatggaaatctttttgtcatggattcattatattccagattcttatc |
39940771 |
T |
 |
| Q |
115 |
tatttcaaggtcctaccttagcattaccaatataatggtcataaactttggactttctttttggataaggtaaccttttgtgcaaagcaatatagcaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39940770 |
tatttcaaggtcctaccttagcattaccaatataatggtcataaactttggactttctttttggataaggtaaccttttgtgcaaagcaatatagcaaaa |
39940671 |
T |
 |
| Q |
215 |
catcctccataaggagcaatatacc |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39940670 |
catcctccataaggagcaatatacc |
39940646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University