View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15309_high_7 (Length: 376)
Name: NF15309_high_7
Description: NF15309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15309_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 9 - 216
Target Start/End: Complemental strand, 41575156 - 41574949
Alignment:
| Q |
9 |
gacatcatcattggatgaggcataaggaaaaatgcgacgaggtcaaacgggcttcacaactaattttagactataatgcgaccatcactttcacagtcga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41575156 |
gacatcatcattggatgaggcataaggaaaaatgtgacgaggccaaacgggcttcacaactaattttagactataatgcgaccatcactttcacagtcga |
41575057 |
T |
 |
| Q |
109 |
cttaaatggtcgtgctaactttagcagcgtgcagaaagcgattgatgccgttcctgaatctagttttaatacaacccttattataatcaattccggtaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41575056 |
cttaaatggtcgtgctaactttagcagcgtgcagaaagcgattgatgccgttcctgaatctagttttaatacaacccttattataatcaattctggtaca |
41574957 |
T |
 |
| Q |
209 |
tacaggtt |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
41574956 |
tacaggtt |
41574949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 289 - 374
Target Start/End: Complemental strand, 41574876 - 41574791
Alignment:
| Q |
289 |
attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatataccgaggtacacc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574876 |
attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatataccgaggtacacc |
41574791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University