View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15309_low_12 (Length: 283)
Name: NF15309_low_12
Description: NF15309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15309_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 266
Target Start/End: Original strand, 17107099 - 17107351
Alignment:
| Q |
14 |
ttctggtgaatttaatgctcttcaaataatgagggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107099 |
ttctggtgaatttaatgctcttcaaataatgagggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaag |
17107198 |
T |
 |
| Q |
114 |
gtagcaaatgaactgaaagggaagaagttttttattgttttggacaatatgtggaatgacgacgaagtggaattggaagatttgaagattccatttcagt |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17107199 |
gtagcaaatgaactgaatgggaagaagttttttattgttttggacaatatgtggaatgacaacgaagtggaattgaaagatttgaagattccatttcagt |
17107298 |
T |
 |
| Q |
214 |
gtggggctgagggaagtaaaatccttgtcactacgcgcaacagtgaagttgct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17107299 |
gtggggctgagggaagtaaaatccttgtcactacgcgcaaaagtgaagttgct |
17107351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 252
Target Start/End: Original strand, 16975970 - 16975999
Alignment:
| Q |
223 |
agggaagtaaaatccttgtcactacgcgca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16975970 |
agggaagtaaaatccttgtcactacgcgca |
16975999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University